Incidental Mutation 'R8082:AI314180'
ID629402
Institutional Source Beutler Lab
Gene Symbol AI314180
Ensembl Gene ENSMUSG00000050812
Gene Nameexpressed sequence AI314180
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R8082 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location58798911-58912749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58807852 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1672 (A1672V)
Ref Sequence ENSEMBL: ENSMUSP00000099953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102889] [ENSMUST00000149301]
Predicted Effect probably benign
Transcript: ENSMUST00000102889
AA Change: A1672V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812
AA Change: A1672V

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 1.1e-155 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1491 3e-31 SMART
low complexity region 1781 1797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149301
SMART Domains Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 4e-163 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1490 8e-32 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,142,121 probably null Het
4921524J17Rik G A 8: 85,409,839 A133V possibly damaging Het
Amd1 A G 10: 40,290,512 F123L probably benign Het
Ankrd34c C A 9: 89,728,715 K524N probably damaging Het
Bicd2 C T 13: 49,379,053 Q372* probably null Het
Cadps2 T A 6: 23,323,314 M1002L probably damaging Het
Calcrl T C 2: 84,370,442 Y86C possibly damaging Het
Ccdc141 T C 2: 77,124,244 I220V probably damaging Het
Cep152 T C 2: 125,586,393 T773A probably benign Het
Cgn A G 3: 94,763,061 F1029L probably benign Het
Cntnap5b T A 1: 100,379,216 M515K probably benign Het
Col6a6 T A 9: 105,783,930 K327* probably null Het
Cspg4 A G 9: 56,885,893 Y304C probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
E130309D02Rik T C 5: 143,311,852 R147G probably benign Het
Emilin3 A C 2: 160,908,146 V561G probably damaging Het
Fam3c T A 6: 22,343,304 D12V unknown Het
Fam83f T C 15: 80,689,918 V158A probably damaging Het
Fgfbp1 T C 5: 43,979,279 R224G probably damaging Het
Gid4 A G 11: 60,436,447 K153E probably damaging Het
Gm13178 A C 4: 144,715,327 F118C probably damaging Het
Gm597 T A 1: 28,777,498 K484N probably benign Het
Hic2 A G 16: 17,258,699 H464R probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Ilvbl C T 10: 78,584,153 R602C probably damaging Het
Izumo1r T A 9: 14,894,077 D171V unknown Het
Kel T A 6: 41,703,490 E12V possibly damaging Het
Klf15 T C 6: 90,466,484 S14P possibly damaging Het
Lars T A 18: 42,244,910 S147C probably damaging Het
Lgals1 C T 15: 78,930,101 A122V probably benign Het
Lgsn C T 1: 31,204,192 H452Y probably benign Het
Lrrc37a T A 11: 103,457,422 I2816F unknown Het
Mcoln1 T A 8: 3,507,420 I142K probably benign Het
Met G A 6: 17,492,313 R358Q probably damaging Het
Mink1 T A 11: 70,613,277 C1276S possibly damaging Het
Mrc1 T C 2: 14,248,960 M264T probably benign Het
Mtfr2 C T 10: 20,353,389 T81M probably benign Het
Myo5c G A 9: 75,275,511 A811T possibly damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Ndufs3 T C 2: 90,894,864 D213G probably damaging Het
Olfr1009 T C 2: 85,721,480 V25A probably benign Het
Olfr1014 T A 2: 85,776,700 L39I probably benign Het
Olfr202 T C 16: 59,284,387 T37A possibly damaging Het
Olfr639 T A 7: 104,012,690 E4V probably benign Het
Otog C T 7: 46,289,719 R2058C probably damaging Het
Pcdh10 A T 3: 45,381,744 K831M probably damaging Het
Polr1b A G 2: 129,115,732 D569G probably benign Het
Polr3b T C 10: 84,656,063 L362P probably damaging Het
Rims2 G T 15: 39,476,523 R871L probably benign Het
Shprh T A 10: 11,151,811 I54N probably benign Het
Sipa1l2 T C 8: 125,491,809 D263G possibly damaging Het
Slc43a1 C T 2: 84,856,900 R382C probably benign Het
Sorbs1 T C 19: 40,365,083 R193G probably benign Het
Sry T A Y: 2,662,589 Q357L unknown Het
Taar8b T A 10: 24,091,891 D135V possibly damaging Het
Tekt3 T G 11: 63,070,230 V75G probably benign Het
Tm7sf2 A G 19: 6,066,321 L198P probably damaging Het
Tuba1a C T 15: 98,950,861 V177I probably benign Het
Wdr60 T A 12: 116,213,507 probably null Het
Other mutations in AI314180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:AI314180 APN 4 58828047 missense possibly damaging 0.95
IGL01145:AI314180 APN 4 58811501 missense probably null 0.08
IGL01371:AI314180 APN 4 58809718 missense probably damaging 1.00
IGL01445:AI314180 APN 4 58833988 missense probably benign 0.08
IGL01452:AI314180 APN 4 58836181 missense probably damaging 0.99
IGL01626:AI314180 APN 4 58832814 splice site probably benign
IGL01672:AI314180 APN 4 58814041 missense probably benign 0.40
IGL01943:AI314180 APN 4 58849937 missense possibly damaging 0.91
IGL01944:AI314180 APN 4 58861544 missense probably benign 0.42
IGL02190:AI314180 APN 4 58800190 missense probably benign 0.12
IGL02272:AI314180 APN 4 58811731 missense probably benign 0.00
IGL02435:AI314180 APN 4 58830325 splice site probably benign
IGL02516:AI314180 APN 4 58877102 missense probably damaging 1.00
IGL02540:AI314180 APN 4 58805534 splice site probably benign
IGL02709:AI314180 APN 4 58872699 missense possibly damaging 0.90
IGL02742:AI314180 APN 4 58840757 missense probably damaging 0.96
IGL02812:AI314180 APN 4 58864343 splice site probably benign
IGL02828:AI314180 APN 4 58875512 missense possibly damaging 0.59
IGL03130:AI314180 APN 4 58800288 missense probably benign
IGL03179:AI314180 APN 4 58832777 missense probably damaging 1.00
IGL03237:AI314180 APN 4 58810668 missense probably benign 0.40
IGL03344:AI314180 APN 4 58828538 missense probably damaging 1.00
BB006:AI314180 UTSW 4 58869554 missense probably damaging 1.00
BB016:AI314180 UTSW 4 58869554 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0313:AI314180 UTSW 4 58811892 missense probably benign 0.11
R0399:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R0487:AI314180 UTSW 4 58819155 missense probably damaging 1.00
R0492:AI314180 UTSW 4 58864418 missense probably damaging 1.00
R0705:AI314180 UTSW 4 58885366 critical splice donor site probably null
R0847:AI314180 UTSW 4 58841439 missense probably benign 0.14
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1482:AI314180 UTSW 4 58820163 missense possibly damaging 0.85
R1529:AI314180 UTSW 4 58832701 splice site probably null
R1771:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1776:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1822:AI314180 UTSW 4 58805539 critical splice donor site probably null
R1864:AI314180 UTSW 4 58849942 missense possibly damaging 0.62
R2029:AI314180 UTSW 4 58844165 nonsense probably null
R2061:AI314180 UTSW 4 58824270 missense probably damaging 1.00
R2125:AI314180 UTSW 4 58833978 missense probably benign
R2266:AI314180 UTSW 4 58830332 critical splice donor site probably null
R2889:AI314180 UTSW 4 58836165 missense probably benign
R2902:AI314180 UTSW 4 58809691 missense probably benign 0.31
R2903:AI314180 UTSW 4 58828622 missense possibly damaging 0.50
R2925:AI314180 UTSW 4 58833928 nonsense probably null
R4151:AI314180 UTSW 4 58836254 missense possibly damaging 0.51
R4225:AI314180 UTSW 4 58847027 missense probably damaging 1.00
R4486:AI314180 UTSW 4 58820086 intron probably benign
R4576:AI314180 UTSW 4 58834708 intron probably benign
R4580:AI314180 UTSW 4 58840751 missense probably damaging 1.00
R4654:AI314180 UTSW 4 58834523 missense possibly damaging 0.86
R4688:AI314180 UTSW 4 58840757 missense probably damaging 0.96
R4726:AI314180 UTSW 4 58844191 missense probably damaging 1.00
R4825:AI314180 UTSW 4 58850911 missense probably damaging 0.99
R4928:AI314180 UTSW 4 58827073 missense probably damaging 1.00
R5098:AI314180 UTSW 4 58877048 missense probably damaging 1.00
R5284:AI314180 UTSW 4 58836172 missense possibly damaging 0.90
R5375:AI314180 UTSW 4 58809401 nonsense probably null
R5382:AI314180 UTSW 4 58850934 missense probably benign 0.38
R5487:AI314180 UTSW 4 58809421 missense probably benign 0.22
R5703:AI314180 UTSW 4 58877171 splice site probably null
R5761:AI314180 UTSW 4 58853131 missense probably damaging 1.00
R5791:AI314180 UTSW 4 58814027 missense possibly damaging 0.90
R5791:AI314180 UTSW 4 58822111 missense probably damaging 1.00
R5928:AI314180 UTSW 4 58849948 missense possibly damaging 0.59
R6062:AI314180 UTSW 4 58826453 missense possibly damaging 0.84
R6246:AI314180 UTSW 4 58811365 splice site probably null
R6298:AI314180 UTSW 4 58877157 missense probably damaging 1.00
R6326:AI314180 UTSW 4 58827068 missense probably benign 0.34
R6478:AI314180 UTSW 4 58810785 missense probably damaging 1.00
R6707:AI314180 UTSW 4 58879101 missense possibly damaging 0.52
R6846:AI314180 UTSW 4 58814081 missense possibly damaging 0.85
R6857:AI314180 UTSW 4 58814065 missense probably damaging 1.00
R6951:AI314180 UTSW 4 58853114 critical splice donor site probably null
R7088:AI314180 UTSW 4 58849766 missense possibly damaging 0.93
R7302:AI314180 UTSW 4 58834593 missense probably benign 0.43
R7337:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R7341:AI314180 UTSW 4 58809415 missense possibly damaging 0.94
R7344:AI314180 UTSW 4 58824770 missense probably benign 0.08
R7525:AI314180 UTSW 4 58847038 missense possibly damaging 0.84
R7530:AI314180 UTSW 4 58815317 missense probably damaging 0.99
R7533:AI314180 UTSW 4 58809411 missense probably benign 0.12
R7557:AI314180 UTSW 4 58849691 missense possibly damaging 0.85
R7698:AI314180 UTSW 4 58832660 missense unknown
R7793:AI314180 UTSW 4 58853150 missense probably damaging 1.00
R7892:AI314180 UTSW 4 58828593 missense probably benign
R7894:AI314180 UTSW 4 58853708 missense probably damaging 1.00
R7929:AI314180 UTSW 4 58869554 missense probably damaging 1.00
R8010:AI314180 UTSW 4 58832681 missense unknown
R8175:AI314180 UTSW 4 58872756 missense probably damaging 1.00
R8191:AI314180 UTSW 4 58872587 critical splice donor site probably null
R8326:AI314180 UTSW 4 58847093 missense probably damaging 1.00
X0060:AI314180 UTSW 4 58840752 missense possibly damaging 0.73
Z1177:AI314180 UTSW 4 58861614 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTAACAATACAGTGATCCATGTAC -3'
(R):5'- ATCTCCTGTAAAACACTCTGCTTG -3'

Sequencing Primer
(F):5'- CAGTGATCCATGTACTTATTTGCTG -3'
(R):5'- GTAACTTTATTAGAATTCCCTCC -3'
Posted On2020-06-30