Incidental Mutation 'R8082:Cadps2'
ID 629408
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene Name Ca2+-dependent activator protein for secretion 2
Synonyms Caps2, cpd2, A230044C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8082 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 23262773-23839421 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23323314 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 1002 (M1002L)
Ref Sequence ENSEMBL: ENSMUSP00000111018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000018122
AA Change: M1052L

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: M1052L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000069074
AA Change: M1045L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: M1045L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115358
AA Change: M1012L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: M1012L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115361
AA Change: M1002L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: M1002L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125350
AA Change: M647L

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: M647L

DomainStartEndE-ValueType
C2 14 112 1.51e-1 SMART
PH 137 241 2.94e-11 SMART
DUF1041 446 537 1.9e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000142913
AA Change: M1023L

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: M1023L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163871
AA Change: M1052L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: M1052L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166458
AA Change: M1023L

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: M1023L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,142,121 probably null Het
4921524J17Rik G A 8: 85,409,839 A133V possibly damaging Het
AI314180 G A 4: 58,807,852 A1672V probably benign Het
Amd1 A G 10: 40,290,512 F123L probably benign Het
Ankrd34c C A 9: 89,728,715 K524N probably damaging Het
Bicd2 C T 13: 49,379,053 Q372* probably null Het
Calcrl T C 2: 84,370,442 Y86C possibly damaging Het
Ccdc141 T C 2: 77,124,244 I220V probably damaging Het
Cep152 T C 2: 125,586,393 T773A probably benign Het
Cgn A G 3: 94,763,061 F1029L probably benign Het
Cntnap5b T A 1: 100,379,216 M515K probably benign Het
Col6a6 T A 9: 105,783,930 K327* probably null Het
Cspg4 A G 9: 56,885,893 Y304C probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
E130309D02Rik T C 5: 143,311,852 R147G probably benign Het
Emilin3 A C 2: 160,908,146 V561G probably damaging Het
Fam3c T A 6: 22,343,304 D12V unknown Het
Fam83f T C 15: 80,689,918 V158A probably damaging Het
Fgfbp1 T C 5: 43,979,279 R224G probably damaging Het
Gid4 A G 11: 60,436,447 K153E probably damaging Het
Gm13178 A C 4: 144,715,327 F118C probably damaging Het
Gm597 T A 1: 28,777,498 K484N probably benign Het
Hic2 A G 16: 17,258,699 H464R probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Ilvbl C T 10: 78,584,153 R602C probably damaging Het
Izumo1r T A 9: 14,894,077 D171V unknown Het
Kel T A 6: 41,703,490 E12V possibly damaging Het
Klf15 T C 6: 90,466,484 S14P possibly damaging Het
Lars T A 18: 42,244,910 S147C probably damaging Het
Lgals1 C T 15: 78,930,101 A122V probably benign Het
Lgsn C T 1: 31,204,192 H452Y probably benign Het
Lrrc37a T A 11: 103,457,422 I2816F unknown Het
Mcoln1 T A 8: 3,507,420 I142K probably benign Het
Met G A 6: 17,492,313 R358Q probably damaging Het
Mink1 T A 11: 70,613,277 C1276S possibly damaging Het
Mrc1 T C 2: 14,248,960 M264T probably benign Het
Mtfr2 C T 10: 20,353,389 T81M probably benign Het
Myo5c G A 9: 75,275,511 A811T possibly damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Ndufs3 T C 2: 90,894,864 D213G probably damaging Het
Olfr1009 T C 2: 85,721,480 V25A probably benign Het
Olfr1014 T A 2: 85,776,700 L39I probably benign Het
Olfr202 T C 16: 59,284,387 T37A possibly damaging Het
Olfr639 T A 7: 104,012,690 E4V probably benign Het
Otog C T 7: 46,289,719 R2058C probably damaging Het
Pcdh10 A T 3: 45,381,744 K831M probably damaging Het
Polr1b A G 2: 129,115,732 D569G probably benign Het
Polr3b T C 10: 84,656,063 L362P probably damaging Het
Rims2 G T 15: 39,476,523 R871L probably benign Het
Shprh T A 10: 11,151,811 I54N probably benign Het
Sipa1l2 T C 8: 125,491,809 D263G possibly damaging Het
Slc43a1 C T 2: 84,856,900 R382C probably benign Het
Sorbs1 T C 19: 40,365,083 R193G probably benign Het
Sry T A Y: 2,662,589 Q357L unknown Het
Taar8b T A 10: 24,091,891 D135V possibly damaging Het
Tekt3 T G 11: 63,070,230 V75G probably benign Het
Tm7sf2 A G 19: 6,066,321 L198P probably damaging Het
Tuba1a C T 15: 98,950,861 V177I probably benign Het
Wdr60 T A 12: 116,213,507 probably null Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23496874 missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23321700 splice site probably benign
IGL01317:Cadps2 APN 6 23314173 missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23587441 missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23263673 missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23587462 missense probably benign 0.19
IGL01674:Cadps2 APN 6 23355852 missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23382905 missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23427275 missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23427310 missense probably benign 0.01
IGL02200:Cadps2 APN 6 23385528 missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23287732 missense probably benign 0.11
IGL02680:Cadps2 APN 6 23838896 missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23321707 missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23496809 missense probably benign 0.08
IGL03061:Cadps2 APN 6 23287660 splice site probably null
IGL03233:Cadps2 APN 6 23263601 missense probably benign 0.10
R0193:Cadps2 UTSW 6 23599440 missense probably benign 0.00
R0389:Cadps2 UTSW 6 23321782 missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23583412 missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23321704 critical splice donor site probably null
R0620:Cadps2 UTSW 6 23583396 missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23287698 missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23321740 missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23328776 splice site probably benign
R0942:Cadps2 UTSW 6 23263562 missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23838794 missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23583473 splice site probably benign
R1575:Cadps2 UTSW 6 23429218 missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23320932 critical splice donor site probably null
R1924:Cadps2 UTSW 6 23688858 missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23599480 missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23287686 missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23323380 missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23839122 missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23838999 intron probably benign
R2147:Cadps2 UTSW 6 23838999 intron probably benign
R2148:Cadps2 UTSW 6 23838999 intron probably benign
R2150:Cadps2 UTSW 6 23838999 intron probably benign
R2219:Cadps2 UTSW 6 23410832 missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23323340 missense probably benign 0.15
R2338:Cadps2 UTSW 6 23838978 splice site probably benign
R3861:Cadps2 UTSW 6 23355861 missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23528126 missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23263531 utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23599463 missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23412988 missense probably benign 0.18
R4432:Cadps2 UTSW 6 23626738 missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23587579 missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23688860 missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23287743 missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23626668 missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23329104 missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23328805 missense probably benign 0.28
R6074:Cadps2 UTSW 6 23626671 missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23329163 critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23263578 missense probably benign 0.04
R6463:Cadps2 UTSW 6 23323334 nonsense probably null
R6907:Cadps2 UTSW 6 23599506 missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23302492 missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23583459 missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23323409 missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23410889 missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23688956 missense probably benign 0.02
R7184:Cadps2 UTSW 6 23583429 missense probably benign 0.18
R7325:Cadps2 UTSW 6 23409935 missense unknown
R7526:Cadps2 UTSW 6 23496851 missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23626608 missense probably benign 0.15
R7772:Cadps2 UTSW 6 23390446 missense probably benign 0.00
R7870:Cadps2 UTSW 6 23263642 missense probably benign 0.14
R8040:Cadps2 UTSW 6 23412943 splice site probably benign
R8048:Cadps2 UTSW 6 23838863 missense probably benign 0.14
R8100:Cadps2 UTSW 6 23838809 missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23328898 missense probably benign 0.00
R8497:Cadps2 UTSW 6 23355919 missense probably benign 0.27
R8768:Cadps2 UTSW 6 23382939 missense probably damaging 1.00
R8783:Cadps2 UTSW 6 23302304 missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23496806 missense probably damaging 1.00
R8832:Cadps2 UTSW 6 23587537 missense possibly damaging 0.52
R8848:Cadps2 UTSW 6 23344257 missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23385508 missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23410877 missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23344224 missense probably benign 0.11
R8921:Cadps2 UTSW 6 23302301 missense probably benign 0.00
R9228:Cadps2 UTSW 6 23688928 missense probably benign 0.00
R9297:Cadps2 UTSW 6 23496888 missense probably benign
R9318:Cadps2 UTSW 6 23496888 missense probably benign
R9348:Cadps2 UTSW 6 23344263 missense probably benign 0.20
Z1176:Cadps2 UTSW 6 23321801 missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23385478 missense possibly damaging 0.88
Z1177:Cadps2 UTSW 6 23626695 missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23838818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGATTAAGTTCGCCAATTCCATGG -3'
(R):5'- GTGTGTGGCCCATACTGTTAAC -3'

Sequencing Primer
(F):5'- ATTCCATGGTTCCCCAGGATTAAGG -3'
(R):5'- CTGTTAACAGTGGAAGCTCATG -3'
Posted On 2020-06-30