Incidental Mutation 'R8082:Sipa1l2'
ID629415
Institutional Source Beutler Lab
Gene Symbol Sipa1l2
Ensembl Gene ENSMUSG00000001995
Gene Namesignal-induced proliferation-associated 1 like 2
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R8082 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location125418063-125569808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125491809 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 263 (D263G)
Ref Sequence ENSEMBL: ENSMUSP00000104405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108775
AA Change: D263G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: D263G

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
Pfam:Rap_GAP 625 807 2.6e-67 PFAM
PDZ 960 1026 6.47e-9 SMART
low complexity region 1091 1103 N/A INTRINSIC
low complexity region 1120 1138 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
low complexity region 1299 1312 N/A INTRINSIC
low complexity region 1321 1329 N/A INTRINSIC
low complexity region 1334 1355 N/A INTRINSIC
low complexity region 1404 1418 N/A INTRINSIC
Pfam:SPAR_C 1421 1666 2.5e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212168
AA Change: D263G

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212987
AA Change: D263G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,142,121 probably null Het
4921524J17Rik G A 8: 85,409,839 A133V possibly damaging Het
AI314180 G A 4: 58,807,852 A1672V probably benign Het
Amd1 A G 10: 40,290,512 F123L probably benign Het
Ankrd34c C A 9: 89,728,715 K524N probably damaging Het
Bicd2 C T 13: 49,379,053 Q372* probably null Het
Cadps2 T A 6: 23,323,314 M1002L probably damaging Het
Calcrl T C 2: 84,370,442 Y86C possibly damaging Het
Ccdc141 T C 2: 77,124,244 I220V probably damaging Het
Cep152 T C 2: 125,586,393 T773A probably benign Het
Cgn A G 3: 94,763,061 F1029L probably benign Het
Cntnap5b T A 1: 100,379,216 M515K probably benign Het
Col6a6 T A 9: 105,783,930 K327* probably null Het
Cspg4 A G 9: 56,885,893 Y304C probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
E130309D02Rik T C 5: 143,311,852 R147G probably benign Het
Emilin3 A C 2: 160,908,146 V561G probably damaging Het
Fam3c T A 6: 22,343,304 D12V unknown Het
Fam83f T C 15: 80,689,918 V158A probably damaging Het
Fgfbp1 T C 5: 43,979,279 R224G probably damaging Het
Gid4 A G 11: 60,436,447 K153E probably damaging Het
Gm13178 A C 4: 144,715,327 F118C probably damaging Het
Gm597 T A 1: 28,777,498 K484N probably benign Het
Hic2 A G 16: 17,258,699 H464R probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Ilvbl C T 10: 78,584,153 R602C probably damaging Het
Izumo1r T A 9: 14,894,077 D171V unknown Het
Kel T A 6: 41,703,490 E12V possibly damaging Het
Klf15 T C 6: 90,466,484 S14P possibly damaging Het
Lars T A 18: 42,244,910 S147C probably damaging Het
Lgals1 C T 15: 78,930,101 A122V probably benign Het
Lgsn C T 1: 31,204,192 H452Y probably benign Het
Lrrc37a T A 11: 103,457,422 I2816F unknown Het
Mcoln1 T A 8: 3,507,420 I142K probably benign Het
Met G A 6: 17,492,313 R358Q probably damaging Het
Mink1 T A 11: 70,613,277 C1276S possibly damaging Het
Mrc1 T C 2: 14,248,960 M264T probably benign Het
Mtfr2 C T 10: 20,353,389 T81M probably benign Het
Myo5c G A 9: 75,275,511 A811T possibly damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Ndufs3 T C 2: 90,894,864 D213G probably damaging Het
Olfr1009 T C 2: 85,721,480 V25A probably benign Het
Olfr1014 T A 2: 85,776,700 L39I probably benign Het
Olfr202 T C 16: 59,284,387 T37A possibly damaging Het
Olfr639 T A 7: 104,012,690 E4V probably benign Het
Otog C T 7: 46,289,719 R2058C probably damaging Het
Pcdh10 A T 3: 45,381,744 K831M probably damaging Het
Polr1b A G 2: 129,115,732 D569G probably benign Het
Polr3b T C 10: 84,656,063 L362P probably damaging Het
Rims2 G T 15: 39,476,523 R871L probably benign Het
Shprh T A 10: 11,151,811 I54N probably benign Het
Slc43a1 C T 2: 84,856,900 R382C probably benign Het
Sorbs1 T C 19: 40,365,083 R193G probably benign Het
Sry T A Y: 2,662,589 Q357L unknown Het
Taar8b T A 10: 24,091,891 D135V possibly damaging Het
Tekt3 T G 11: 63,070,230 V75G probably benign Het
Tm7sf2 A G 19: 6,066,321 L198P probably damaging Het
Tuba1a C T 15: 98,950,861 V177I probably benign Het
Wdr60 T A 12: 116,213,507 probably null Het
Other mutations in Sipa1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Sipa1l2 APN 8 125491806 missense probably damaging 1.00
IGL00939:Sipa1l2 APN 8 125464435 splice site probably benign
IGL00965:Sipa1l2 APN 8 125447874 missense probably benign 0.02
IGL01321:Sipa1l2 APN 8 125491518 missense probably damaging 1.00
IGL01450:Sipa1l2 APN 8 125422577 critical splice donor site probably null
IGL01753:Sipa1l2 APN 8 125453292 splice site probably benign
IGL01930:Sipa1l2 APN 8 125419239 missense probably damaging 0.99
IGL02041:Sipa1l2 APN 8 125491819 missense probably benign 0.03
IGL02215:Sipa1l2 APN 8 125447837 missense possibly damaging 0.67
IGL02272:Sipa1l2 APN 8 125492011 missense probably damaging 1.00
IGL02370:Sipa1l2 APN 8 125480269 missense probably damaging 1.00
IGL02538:Sipa1l2 APN 8 125451977 missense probably damaging 1.00
IGL02633:Sipa1l2 APN 8 125447768 missense probably damaging 1.00
IGL03394:Sipa1l2 APN 8 125491659 missense possibly damaging 0.67
Rebellious UTSW 8 125468339 missense probably benign 0.01
R0144:Sipa1l2 UTSW 8 125449876 splice site probably null
R0153:Sipa1l2 UTSW 8 125421898 missense probably damaging 0.99
R0276:Sipa1l2 UTSW 8 125421940 missense probably damaging 1.00
R0318:Sipa1l2 UTSW 8 125447697 missense possibly damaging 0.73
R0373:Sipa1l2 UTSW 8 125464410 missense probably damaging 0.99
R0427:Sipa1l2 UTSW 8 125480332 missense probably damaging 1.00
R0634:Sipa1l2 UTSW 8 125422624 nonsense probably null
R1377:Sipa1l2 UTSW 8 125491977 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1435:Sipa1l2 UTSW 8 125468725 missense probably damaging 1.00
R1523:Sipa1l2 UTSW 8 125447613 missense possibly damaging 0.75
R1577:Sipa1l2 UTSW 8 125492262 missense probably benign 0.00
R1581:Sipa1l2 UTSW 8 125491617 missense probably damaging 0.96
R1583:Sipa1l2 UTSW 8 125421895 missense probably damaging 0.97
R1719:Sipa1l2 UTSW 8 125444535 missense probably damaging 0.99
R1730:Sipa1l2 UTSW 8 125480141 splice site probably null
R1940:Sipa1l2 UTSW 8 125480148 splice site probably benign
R2007:Sipa1l2 UTSW 8 125439437 missense probably damaging 1.00
R2141:Sipa1l2 UTSW 8 125491491 missense probably benign 0.07
R2203:Sipa1l2 UTSW 8 125491627 missense probably damaging 0.99
R2764:Sipa1l2 UTSW 8 125492374 missense probably damaging 0.99
R3722:Sipa1l2 UTSW 8 125473584 missense probably damaging 1.00
R3787:Sipa1l2 UTSW 8 125423205 missense probably benign
R3787:Sipa1l2 UTSW 8 125450383 missense possibly damaging 0.52
R4106:Sipa1l2 UTSW 8 125492308 missense probably damaging 1.00
R4117:Sipa1l2 UTSW 8 125468510 missense probably damaging 1.00
R4194:Sipa1l2 UTSW 8 125491672 missense probably benign 0.00
R4237:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4240:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4448:Sipa1l2 UTSW 8 125492355 missense probably damaging 1.00
R4515:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4519:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4523:Sipa1l2 UTSW 8 125492424 missense probably damaging 1.00
R4557:Sipa1l2 UTSW 8 125464415 missense probably damaging 0.98
R4667:Sipa1l2 UTSW 8 125453470 missense possibly damaging 0.93
R4687:Sipa1l2 UTSW 8 125491245 missense probably damaging 1.00
R4854:Sipa1l2 UTSW 8 125473601 missense probably damaging 1.00
R4890:Sipa1l2 UTSW 8 125491867 missense probably damaging 1.00
R5065:Sipa1l2 UTSW 8 125491585 missense probably benign 0.19
R5194:Sipa1l2 UTSW 8 125439273 missense possibly damaging 0.48
R5266:Sipa1l2 UTSW 8 125492126 missense probably damaging 0.99
R5475:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R5718:Sipa1l2 UTSW 8 125491248 missense probably damaging 1.00
R5910:Sipa1l2 UTSW 8 125491684 missense probably benign 0.42
R5916:Sipa1l2 UTSW 8 125468573 missense probably damaging 1.00
R5941:Sipa1l2 UTSW 8 125473536 missense probably damaging 0.99
R6083:Sipa1l2 UTSW 8 125468473 missense possibly damaging 0.87
R6185:Sipa1l2 UTSW 8 125468253 nonsense probably null
R6235:Sipa1l2 UTSW 8 125474871 missense probably damaging 1.00
R6274:Sipa1l2 UTSW 8 125469872 missense probably damaging 1.00
R6299:Sipa1l2 UTSW 8 125453464 missense possibly damaging 0.75
R6374:Sipa1l2 UTSW 8 125444630 missense probably damaging 1.00
R6459:Sipa1l2 UTSW 8 125444484 critical splice donor site probably null
R6462:Sipa1l2 UTSW 8 125491230 missense probably damaging 1.00
R6496:Sipa1l2 UTSW 8 125449894 missense probably benign 0.00
R6543:Sipa1l2 UTSW 8 125450362 missense possibly damaging 0.50
R7154:Sipa1l2 UTSW 8 125468339 missense probably benign 0.01
R7192:Sipa1l2 UTSW 8 125422609 missense probably benign 0.09
R7240:Sipa1l2 UTSW 8 125469860 missense probably damaging 1.00
R7361:Sipa1l2 UTSW 8 125453332 missense probably damaging 1.00
R7383:Sipa1l2 UTSW 8 125447646 missense probably damaging 1.00
R7417:Sipa1l2 UTSW 8 125482106 missense possibly damaging 0.93
R7604:Sipa1l2 UTSW 8 125419272 missense probably benign 0.45
R7658:Sipa1l2 UTSW 8 125492290 missense probably benign 0.00
R7743:Sipa1l2 UTSW 8 125464233 missense probably damaging 1.00
R7781:Sipa1l2 UTSW 8 125491827 missense possibly damaging 0.46
R7812:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R7829:Sipa1l2 UTSW 8 125451988 missense probably damaging 1.00
R7880:Sipa1l2 UTSW 8 125464393 missense probably damaging 1.00
R7884:Sipa1l2 UTSW 8 125447598 missense probably benign
R8057:Sipa1l2 UTSW 8 125468530 missense probably damaging 1.00
R8092:Sipa1l2 UTSW 8 125419168 missense probably benign 0.03
R8247:Sipa1l2 UTSW 8 125422633 missense probably benign 0.29
R8252:Sipa1l2 UTSW 8 125468671 missense probably damaging 1.00
R8386:Sipa1l2 UTSW 8 125492093 missense probably damaging 1.00
X0027:Sipa1l2 UTSW 8 125492136 missense probably damaging 1.00
Z1177:Sipa1l2 UTSW 8 125447556 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TAATGGGCAAAGCACCTCTG -3'
(R):5'- TCTATTGACAGGCAGGGTCTG -3'

Sequencing Primer
(F):5'- ACCTCTGGCAACTCCATGG -3'
(R):5'- CTGTCTGGAGAGAATGTTTTCGCC -3'
Posted On2020-06-30