Mutagenetix > Incidental Mutation

Incidental Mutation 'R8082:Shprh'

629421

Institutional Source

Beutler Lab

Gene Symbol

Shprh

Ensembl Gene

ENSMUSG00000090112

Gene Name

SNF2 histone linker PHD RING helicase

Synonyms

2610103K11Rik, D230017O13Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8082 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

11149427-11217595 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 11151811 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 54 (I54N)

Ref Sequence

ENSEMBL: ENSMUSP00000039422 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810]

AlphaFold

Q7TPQ3

Predicted Effect

probably benign
Transcript: ENSMUST00000044053
AA Change: I54N

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: I54N

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
Pfam:Helicase_C	1500	1613	1.6e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000054814
AA Change: I54N

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: I54N

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
SCOP:d1fuka_	1504	1616	6e-8	SMART
Blast:HELICc	1533	1613	4e-46	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159541
AA Change: I54N

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: I54N

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
SCOP:d1fuka_	1504	1619	4e-8	SMART
Blast:HELICc	1533	1613	6e-46	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159810
AA Change: I54N

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112
AA Change: I54N

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	2e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
Blast:DEXDc	948	1026	2e-9	BLAST

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	C	12: 71,142,121		probably null	Het
4921524J17Rik	G	A	8: 85,409,839	A133V	possibly damaging	Het
AI314180	G	A	4: 58,807,852	A1672V	probably benign	Het
Amd1	A	G	10: 40,290,512	F123L	probably benign	Het
Ankrd34c	C	A	9: 89,728,715	K524N	probably damaging	Het
Bicd2	C	T	13: 49,379,053	Q372*	probably null	Het
Cadps2	T	A	6: 23,323,314	M1002L	probably damaging	Het
Calcrl	T	C	2: 84,370,442	Y86C	possibly damaging	Het
Ccdc141	T	C	2: 77,124,244	I220V	probably damaging	Het
Cep152	T	C	2: 125,586,393	T773A	probably benign	Het
Cgn	A	G	3: 94,763,061	F1029L	probably benign	Het
Cntnap5b	T	A	1: 100,379,216	M515K	probably benign	Het
Col6a6	T	A	9: 105,783,930	K327*	probably null	Het
Cspg4	A	G	9: 56,885,893	Y304C	probably damaging	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
E130309D02Rik	T	C	5: 143,311,852	R147G	probably benign	Het
Emilin3	A	C	2: 160,908,146	V561G	probably damaging	Het
Fam3c	T	A	6: 22,343,304	D12V	unknown	Het
Fam83f	T	C	15: 80,689,918	V158A	probably damaging	Het
Fgfbp1	T	C	5: 43,979,279	R224G	probably damaging	Het
Gid4	A	G	11: 60,436,447	K153E	probably damaging	Het
Gm13178	A	C	4: 144,715,327	F118C	probably damaging	Het
Gm597	T	A	1: 28,777,498	K484N	probably benign	Het
Hic2	A	G	16: 17,258,699	H464R	probably damaging	Het
Hist2h3b	C	A	3: 96,268,993	Y100*	probably null	Het
Ilvbl	C	T	10: 78,584,153	R602C	probably damaging	Het
Izumo1r	T	A	9: 14,894,077	D171V	unknown	Het
Kel	T	A	6: 41,703,490	E12V	possibly damaging	Het
Klf15	T	C	6: 90,466,484	S14P	possibly damaging	Het
Lars	T	A	18: 42,244,910	S147C	probably damaging	Het
Lgals1	C	T	15: 78,930,101	A122V	probably benign	Het
Lgsn	C	T	1: 31,204,192	H452Y	probably benign	Het
Lrrc37a	T	A	11: 103,457,422	I2816F	unknown	Het
Mcoln1	T	A	8: 3,507,420	I142K	probably benign	Het
Met	G	A	6: 17,492,313	R358Q	probably damaging	Het
Mink1	T	A	11: 70,613,277	C1276S	possibly damaging	Het
Mrc1	T	C	2: 14,248,960	M264T	probably benign	Het
Mtfr2	C	T	10: 20,353,389	T81M	probably benign	Het
Myo5c	G	A	9: 75,275,511	A811T	possibly damaging	Het
Naip6	C	A	13: 100,300,401	S538I	probably benign	Het
Naip6	T	C	13: 100,300,453	T521A	probably benign	Het
Ndufs3	T	C	2: 90,894,864	D213G	probably damaging	Het
Olfr1009	T	C	2: 85,721,480	V25A	probably benign	Het
Olfr1014	T	A	2: 85,776,700	L39I	probably benign	Het
Olfr202	T	C	16: 59,284,387	T37A	possibly damaging	Het
Olfr639	T	A	7: 104,012,690	E4V	probably benign	Het
Otog	C	T	7: 46,289,719	R2058C	probably damaging	Het
Pcdh10	A	T	3: 45,381,744	K831M	probably damaging	Het
Polr1b	A	G	2: 129,115,732	D569G	probably benign	Het
Polr3b	T	C	10: 84,656,063	L362P	probably damaging	Het
Rims2	G	T	15: 39,476,523	R871L	probably benign	Het
Sipa1l2	T	C	8: 125,491,809	D263G	possibly damaging	Het
Slc43a1	C	T	2: 84,856,900	R382C	probably benign	Het
Sorbs1	T	C	19: 40,365,083	R193G	probably benign	Het
Sry	T	A	Y: 2,662,589	Q357L	unknown	Het
Taar8b	T	A	10: 24,091,891	D135V	possibly damaging	Het
Tekt3	T	G	11: 63,070,230	V75G	probably benign	Het
Tm7sf2	A	G	19: 6,066,321	L198P	probably damaging	Het
Tuba1a	C	T	15: 98,950,861	V177I	probably benign	Het
Wdr60	T	A	12: 116,213,507		probably null	Het

Other mutations in Shprh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Shprh	APN	10	11188158	missense	probably damaging	1.00
IGL00583:Shprh	APN	10	11188020	missense	probably benign	0.37
IGL00684:Shprh	APN	10	11163037	missense	probably benign	0.11
IGL01295:Shprh	APN	10	11183868	missense	probably damaging	0.96
IGL01387:Shprh	APN	10	11170254	missense	probably damaging	1.00
IGL01635:Shprh	APN	10	11170019	nonsense	probably null
IGL01833:Shprh	APN	10	11191062	missense	probably damaging	1.00
IGL02013:Shprh	APN	10	11181502	splice site	probably benign
IGL02502:Shprh	APN	10	11194357	missense	possibly damaging	0.66
IGL02819:Shprh	APN	10	11154765	missense	possibly damaging	0.93
PIT4581001:Shprh	UTSW	10	11192494	frame shift	probably null
R0010:Shprh	UTSW	10	11151931	missense	probably benign
R0010:Shprh	UTSW	10	11151931	missense	probably benign
R0053:Shprh	UTSW	10	11194372	splice site	probably null
R0053:Shprh	UTSW	10	11194372	splice site	probably null
R0255:Shprh	UTSW	10	11186391	missense	possibly damaging	0.92
R0325:Shprh	UTSW	10	11170109	missense	probably benign	0.00
R0331:Shprh	UTSW	10	11194170	splice site	probably benign
R0494:Shprh	UTSW	10	11157191	missense	probably damaging	1.00
R0532:Shprh	UTSW	10	11162812	missense	possibly damaging	0.90
R0546:Shprh	UTSW	10	11183887	splice site	probably benign
R0574:Shprh	UTSW	10	11163077	unclassified	probably benign
R0605:Shprh	UTSW	10	11207112	missense	probably damaging	1.00
R0662:Shprh	UTSW	10	11186847	missense	probably damaging	1.00
R1148:Shprh	UTSW	10	11213482	missense	possibly damaging	0.95
R1148:Shprh	UTSW	10	11213482	missense	possibly damaging	0.95
R1263:Shprh	UTSW	10	11159530	missense	probably damaging	1.00
R1588:Shprh	UTSW	10	11164744	missense	probably damaging	1.00
R1638:Shprh	UTSW	10	11157078	missense	probably benign
R1830:Shprh	UTSW	10	11186911	splice site	probably null
R1898:Shprh	UTSW	10	11186869	missense	probably damaging	1.00
R1903:Shprh	UTSW	10	11183797	nonsense	probably null
R2060:Shprh	UTSW	10	11152120	missense	probably benign	0.03
R2225:Shprh	UTSW	10	11162235	unclassified	probably benign
R2363:Shprh	UTSW	10	11171953	missense	probably damaging	1.00
R2509:Shprh	UTSW	10	11166724	missense	probably damaging	1.00
R2891:Shprh	UTSW	10	11164356	missense	probably damaging	1.00
R3077:Shprh	UTSW	10	11170413	missense	probably damaging	1.00
R3150:Shprh	UTSW	10	11170030	missense	probably damaging	0.97
R3796:Shprh	UTSW	10	11178757	missense	possibly damaging	0.89
R4196:Shprh	UTSW	10	11207860	utr 3 prime	probably benign
R4423:Shprh	UTSW	10	11186518	missense	possibly damaging	0.82
R4488:Shprh	UTSW	10	11160471	missense	probably benign	0.17
R4748:Shprh	UTSW	10	11170476	missense	probably damaging	1.00
R4768:Shprh	UTSW	10	11181540	missense	probably damaging	0.96
R4867:Shprh	UTSW	10	11164557	missense	probably benign	0.00
R4937:Shprh	UTSW	10	11157119	missense	probably benign
R5140:Shprh	UTSW	10	11154705	missense	probably benign	0.03
R5318:Shprh	UTSW	10	11166557	missense	probably benign	0.04
R5323:Shprh	UTSW	10	11170297	splice site	probably null
R5450:Shprh	UTSW	10	11212330	missense	possibly damaging	0.70
R5872:Shprh	UTSW	10	11188073	missense	probably damaging	1.00
R6030:Shprh	UTSW	10	11151991	missense	probably benign	0.37
R6030:Shprh	UTSW	10	11151991	missense	probably benign	0.37
R6392:Shprh	UTSW	10	11178741	nonsense	probably null
R6416:Shprh	UTSW	10	11167873	missense	probably damaging	1.00
R6470:Shprh	UTSW	10	11171937	missense	probably damaging	0.98
R6513:Shprh	UTSW	10	11186893	missense	probably damaging	1.00
R6530:Shprh	UTSW	10	11194267	missense	probably benign	0.02
R6678:Shprh	UTSW	10	11166545	missense	probably benign	0.16
R6757:Shprh	UTSW	10	11181508	splice site	probably null
R6971:Shprh	UTSW	10	11166693	missense	probably damaging	1.00
R7158:Shprh	UTSW	10	11166730	missense	probably damaging	0.98
R7582:Shprh	UTSW	10	11164705	missense	probably benign
R7757:Shprh	UTSW	10	11162180	missense	probably benign	0.30
R7812:Shprh	UTSW	10	11151991	missense	probably benign
R7998:Shprh	UTSW	10	11185341	missense	probably damaging	1.00
R8061:Shprh	UTSW	10	11212333	missense	possibly damaging	0.71
R8116:Shprh	UTSW	10	11213461	missense	probably damaging	0.99
R8390:Shprh	UTSW	10	11187983	missense	possibly damaging	0.92
R8445:Shprh	UTSW	10	11181569	missense	possibly damaging	0.92
R8530:Shprh	UTSW	10	11151934	missense	probably benign	0.37
R8759:Shprh	UTSW	10	11157164	missense	possibly damaging	0.92
R8937:Shprh	UTSW	10	11185437	missense	possibly damaging	0.60
R8995:Shprh	UTSW	10	11164830	nonsense	probably null
R9053:Shprh	UTSW	10	11154702	missense	probably benign	0.04
R9131:Shprh	UTSW	10	11162845	missense	possibly damaging	0.58
R9176:Shprh	UTSW	10	11160576	missense	probably benign	0.02
R9391:Shprh	UTSW	10	11162889	missense	probably benign	0.05
R9423:Shprh	UTSW	10	11205263	missense	probably damaging	1.00
R9563:Shprh	UTSW	10	11166491	nonsense	probably null
R9668:Shprh	UTSW	10	11206332	missense	probably damaging	0.97
R9709:Shprh	UTSW	10	11162830	missense	possibly damaging	0.91
R9718:Shprh	UTSW	10	11213504	missense	probably damaging	1.00
R9750:Shprh	UTSW	10	11164460	missense	probably damaging	0.98
RF012:Shprh	UTSW	10	11164841	missense	probably benign	0.02
V8831:Shprh	UTSW	10	11186862	missense	probably damaging	1.00
Z1176:Shprh	UTSW	10	11164553	missense	probably benign
Z1176:Shprh	UTSW	10	11186447	missense	probably damaging	1.00
Z1177:Shprh	UTSW	10	11151762	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GCCAGAGGCTTTAACCAGAC -3'
(R):5'- TCTCTTTGGGGAGAAGCTGAAG -3'

Sequencing Primer
(F):5'- CAGAGGCTTTAACCAGACTTGACTG -3'
(R):5'- GAGCAAAATCTCCCAGAAATGCTTTC -3'

Posted On

2020-06-30