Incidental Mutation 'R8083:Rbm12b1'
ID629459
Institutional Source Beutler Lab
Gene Symbol Rbm12b1
Ensembl Gene ENSMUSG00000046667
Gene NameRNA binding motif protein 12 B1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R8083 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location12140264-12146731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12146409 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 794 (Y794H)
Ref Sequence ENSEMBL: ENSMUSP00000053555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050069] [ENSMUST00000069128]
Predicted Effect probably damaging
Transcript: ENSMUST00000050069
AA Change: Y794H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053555
Gene: ENSMUSG00000046667
AA Change: Y794H

DomainStartEndE-ValueType
RRM 4 72 2.1e-1 SMART
low complexity region 115 125 N/A INTRINSIC
RRM 155 225 5.59e-4 SMART
RRM 284 355 4.87e-4 SMART
RRM 402 474 2.28e-9 SMART
RRM 761 834 1.51e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000069128
AA Change: Y794H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064195
Gene: ENSMUSG00000046667
AA Change: Y794H

DomainStartEndE-ValueType
RRM 4 72 2.1e-1 SMART
low complexity region 115 125 N/A INTRINSIC
RRM 155 225 5.59e-4 SMART
RRM 284 355 4.87e-4 SMART
RRM 402 474 2.28e-9 SMART
RRM 761 834 1.51e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A G 2: 152,441,067 E255G possibly damaging Het
Abcg5 A T 17: 84,658,543 L635Q probably damaging Het
Acsl3 G A 1: 78,692,127 D238N probably damaging Het
Adam32 A T 8: 24,872,736 C558S probably damaging Het
Adamtsl4 C T 3: 95,684,401 V126M possibly damaging Het
Apobec1 G A 6: 122,578,929 P190S probably damaging Het
Arel1 A T 12: 84,940,362 H93Q probably benign Het
Bpifa2 T G 2: 154,010,492 V96G probably damaging Het
Cacna1s G A 1: 136,095,791 V923I possibly damaging Het
Caprin2 A C 6: 148,842,848 Y1026* probably null Het
Cdk8 T G 5: 146,268,290 W34G probably damaging Het
Cdkn3 A T 14: 46,762,601 Q28L probably benign Het
Cfap58 A G 19: 47,983,518 E629G probably damaging Het
Chaf1b T A 16: 93,894,742 C255S probably damaging Het
Clcn4 A G 7: 7,291,428 F445L possibly damaging Het
Cpne6 A C 14: 55,513,241 I140L probably benign Het
Cyp2b23 C A 7: 26,686,403 A10S possibly damaging Het
Eci3 G T 13: 34,956,890 T103K probably benign Het
Eri3 T A 4: 117,593,162 M253K probably damaging Het
Fnip2 G A 3: 79,465,661 R1037W probably damaging Het
Gm21103 C T 14: 6,301,907 V169M possibly damaging Het
Gm6594 G A 17: 82,539,468 A71T probably benign Het
Gns T C 10: 121,378,103 S228P probably damaging Het
Hbegf A T 18: 36,515,171 S46T probably benign Het
Hcn1 GCAACAACA GCAACAACAACA 13: 117,975,760 probably benign Het
Mgrn1 G T 16: 4,886,332 probably benign Het
Nfasc T C 1: 132,596,582 D846G probably benign Het
Nt5dc2 A G 14: 31,134,826 Y103C probably damaging Het
Osbpl9 C T 4: 109,086,375 V147M possibly damaging Het
Pid1 T C 1: 84,038,249 I146V probably benign Het
Rangap1 A G 15: 81,718,900 I108T probably benign Het
Rprd1b T C 2: 158,050,132 S192P probably damaging Het
Sacs A T 14: 61,210,717 D3404V possibly damaging Het
Setd5 G T 6: 113,115,010 G264V probably damaging Het
Snx15 G A 19: 6,120,722 T229I probably damaging Het
Tagln2 A T 1: 172,505,199 I18F possibly damaging Het
Ttc17 C A 2: 94,374,564 V338F probably damaging Het
Xirp2 T A 2: 67,508,699 M428K possibly damaging Het
Zfp503 A T 14: 21,986,064 D261E probably damaging Het
Zfp784 T C 7: 5,035,906 T218A possibly damaging Het
Zp3 A C 5: 135,984,522 D236A probably damaging Het
Other mutations in Rbm12b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Rbm12b1 APN 4 12146038 missense probably damaging 0.99
IGL02103:Rbm12b1 APN 4 12145563 missense probably damaging 0.99
IGL03165:Rbm12b1 APN 4 12145845 missense possibly damaging 0.94
PIT4618001:Rbm12b1 UTSW 4 12145441 missense probably damaging 1.00
R0449:Rbm12b1 UTSW 4 12145507 missense probably benign 0.00
R0528:Rbm12b1 UTSW 4 12145657 missense probably benign 0.00
R0571:Rbm12b1 UTSW 4 12146248 missense probably benign 0.00
R1476:Rbm12b1 UTSW 4 12145817 missense possibly damaging 0.74
R1709:Rbm12b1 UTSW 4 12145827 missense probably benign 0.00
R1759:Rbm12b1 UTSW 4 12145424 missense probably damaging 1.00
R1967:Rbm12b1 UTSW 4 12146304 missense probably benign 0.00
R2055:Rbm12b1 UTSW 4 12145606 missense probably benign 0.05
R2425:Rbm12b1 UTSW 4 12146443 missense probably damaging 0.99
R4015:Rbm12b1 UTSW 4 12145491 missense probably benign 0.04
R4332:Rbm12b1 UTSW 4 12145655 missense probably benign 0.02
R5773:Rbm12b1 UTSW 4 12145765 missense probably damaging 1.00
R6497:Rbm12b1 UTSW 4 12146431 missense probably benign 0.00
R7740:Rbm12b1 UTSW 4 12145954 missense probably benign 0.00
R7761:Rbm12b1 UTSW 4 12146460 missense possibly damaging 0.92
R8129:Rbm12b1 UTSW 4 12145549 missense probably damaging 1.00
Z1088:Rbm12b1 UTSW 4 12146079 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTTTGGGAACTTTGATCATCTACAAG -3'
(R):5'- CACTGCATGAACACTGTGGAAG -3'

Sequencing Primer
(F):5'- GGAACTTTGATCATCTACAAGGTGGC -3'
(R):5'- GAAAACTGTTTACTTAGAAAGGCCC -3'
Posted On2020-06-30