Incidental Mutation 'R8083:Gns'
ID629471
Institutional Source Beutler Lab
Gene Symbol Gns
Ensembl Gene ENSMUSG00000034707
Gene Nameglucosamine (N-acetyl)-6-sulfatase
SynonymsG6S, 2610016K11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R8083 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location121365090-121397249 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121378103 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 228 (S228P)
Ref Sequence ENSEMBL: ENSMUSP00000043167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040344] [ENSMUST00000219249] [ENSMUST00000219505] [ENSMUST00000219851]
Predicted Effect probably damaging
Transcript: ENSMUST00000040344
AA Change: S228P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043167
Gene: ENSMUSG00000034707
AA Change: S228P

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:Sulfatase 39 376 1.4e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219249
Predicted Effect silent
Transcript: ENSMUST00000219505
Predicted Effect probably benign
Transcript: ENSMUST00000219851
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a lysosomal enzyme found in all cells. It is involved in the catabolism of heparin, heparan sulphate, and keratan sulphate. Deficiency of this enzyme results in the accumulation of undegraded substrate and the lysosomal storage disorder mucopolysaccharidosis type IIID (Sanfilippo D syndrome). Mucopolysaccharidosis type IIID is the least common of the four subtypes of Sanfilippo syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous KO results in progressive lysosomal glycosaminoglycan accumulation in the central nervous system and peripheral organs and causes hypoactivity and shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A G 2: 152,441,067 E255G possibly damaging Het
Abcg5 A T 17: 84,658,543 L635Q probably damaging Het
Acsl3 G A 1: 78,692,127 D238N probably damaging Het
Adam32 A T 8: 24,872,736 C558S probably damaging Het
Adamtsl4 C T 3: 95,684,401 V126M possibly damaging Het
Apobec1 G A 6: 122,578,929 P190S probably damaging Het
Arel1 A T 12: 84,940,362 H93Q probably benign Het
Bpifa2 T G 2: 154,010,492 V96G probably damaging Het
Cacna1s G A 1: 136,095,791 V923I possibly damaging Het
Caprin2 A C 6: 148,842,848 Y1026* probably null Het
Cdk8 T G 5: 146,268,290 W34G probably damaging Het
Cdkn3 A T 14: 46,762,601 Q28L probably benign Het
Cfap58 A G 19: 47,983,518 E629G probably damaging Het
Chaf1b T A 16: 93,894,742 C255S probably damaging Het
Clcn4 A G 7: 7,291,428 F445L possibly damaging Het
Cpne6 A C 14: 55,513,241 I140L probably benign Het
Cyp2b23 C A 7: 26,686,403 A10S possibly damaging Het
Eci3 G T 13: 34,956,890 T103K probably benign Het
Eri3 T A 4: 117,593,162 M253K probably damaging Het
Gm21103 C T 14: 6,301,907 V169M possibly damaging Het
Gm35060 T C 18: 32,458,754 probably null Het
Gm6594 G A 17: 82,539,468 A71T probably benign Het
Hbegf A T 18: 36,515,171 S46T probably benign Het
Hcn1 GCAACAACA GCAACAACAACA 13: 117,975,760 probably benign Het
Mcf2l T A 8: 13,007,875 probably null Het
Nfasc T C 1: 132,596,582 D846G probably benign Het
Nt5dc2 A G 14: 31,134,826 Y103C probably damaging Het
Osbpl9 C T 4: 109,086,375 V147M possibly damaging Het
Pid1 T C 1: 84,038,249 I146V probably benign Het
Rangap1 A G 15: 81,718,900 I108T probably benign Het
Rbm12b1 T C 4: 12,146,409 Y794H probably damaging Het
Rprd1b T C 2: 158,050,132 S192P probably damaging Het
Sacs A T 14: 61,210,717 D3404V possibly damaging Het
Setd5 G T 6: 113,115,010 G264V probably damaging Het
Tagln2 A T 1: 172,505,199 I18F possibly damaging Het
Ttc17 C A 2: 94,374,564 V338F probably damaging Het
Xirp2 T A 2: 67,508,699 M428K possibly damaging Het
Zfp503 A T 14: 21,986,064 D261E probably damaging Het
Zfp784 T C 7: 5,035,906 T218A possibly damaging Het
Zp3 A C 5: 135,984,522 D236A probably damaging Het
Other mutations in Gns
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02097:Gns APN 10 121390693 missense probably benign 0.01
PIT4402001:Gns UTSW 10 121376706 missense probably damaging 1.00
R0086:Gns UTSW 10 121391473 missense probably damaging 1.00
R0344:Gns UTSW 10 121383423 missense probably benign 0.04
R0544:Gns UTSW 10 121376267 nonsense probably null
R0626:Gns UTSW 10 121383444 critical splice donor site probably null
R1770:Gns UTSW 10 121378047 missense probably benign 0.00
R2142:Gns UTSW 10 121392778 missense probably damaging 1.00
R4036:Gns UTSW 10 121371190 missense probably damaging 1.00
R4451:Gns UTSW 10 121376696 missense probably damaging 1.00
R4569:Gns UTSW 10 121381178 missense probably benign 0.00
R5264:Gns UTSW 10 121380185 missense probably benign 0.12
R5467:Gns UTSW 10 121391446 missense probably benign 0.00
R7268:Gns UTSW 10 121376652 missense probably damaging 1.00
R7588:Gns UTSW 10 121390658 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CTGCACATGACCATGAAATGAAAG -3'
(R):5'- AAAGGAGCCCGTTTCCAAG -3'

Sequencing Primer
(F):5'- TGCTCTCTCTGTCTACCAAGAGAAAC -3'
(R):5'- AAGGCTTGACGCTTCCTGAC -3'
Posted On2020-06-30