Mutagenetix > Incidental Mutations

Incidental Mutation 'R8083:Arel1'

629472

Institutional Source

Beutler Lab

Gene Symbol

Arel1

Ensembl Gene

ENSMUSG00000042350

Gene Name

apoptosis resistant E3 ubiquitin protein ligase 1

Synonyms

1110018G07Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.523) question?

Stock #

R8083 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84918148-84970900 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 84940362 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 93 (H93Q)

Ref Sequence

ENSEMBL: ENSMUSP00000048780 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043169] [ENSMUST00000163231] [ENSMUST00000163372] [ENSMUST00000165093] [ENSMUST00000165886] [ENSMUST00000167448] [ENSMUST00000169161]

Predicted Effect

probably benign
Transcript: ENSMUST00000043169
AA Change: H93Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000048780
Gene: ENSMUSG00000042350
AA Change: H93Q

Domain	Start	End	E-Value	Type
transmembrane domain	2	19	N/A	INTRINSIC
IG_FLMN	56	160	4.53e-2	SMART
low complexity region	346	360	N/A	INTRINSIC
Blast:HECTc	401	474	6e-39	BLAST
HECTc	481	823	1.04e-158	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163231
AA Change: H93Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000129213
Gene: ENSMUSG00000042350
AA Change: H93Q

Domain	Start	End	E-Value	Type
transmembrane domain	2	19	N/A	INTRINSIC
IG_FLMN	56	160	4.53e-2	SMART
low complexity region	346	360	N/A	INTRINSIC
Blast:HECTc	386	474	1e-51	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000163372

SMART Domains

Protein: ENSMUSP00000130259
Gene: ENSMUSG00000042350

Domain	Start	End	E-Value	Type
transmembrane domain	4	26	N/A	INTRINSIC
Blast:IG_FLMN	56	81	7e-13	BLAST
SCOP:d1qfha1	56	81	4e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165093

SMART Domains

Protein: ENSMUSP00000129147
Gene: ENSMUSG00000042350

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165886

SMART Domains

Protein: ENSMUSP00000126508
Gene: ENSMUSG00000042350

Domain	Start	End	E-Value	Type
transmembrane domain	4	26	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167448

SMART Domains

Protein: ENSMUSP00000127426
Gene: ENSMUSG00000042350

Domain	Start	End	E-Value	Type
transmembrane domain	4	26	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169161
AA Change: H93Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000126523
Gene: ENSMUSG00000042350
AA Change: H93Q

Domain	Start	End	E-Value	Type
transmembrane domain	2	19	N/A	INTRINSIC
IG_FLMN	56	160	4.53e-2	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 95.5%

Validation Efficiency

98% (51/52)

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	A	G	2: 152,441,067	E255G	possibly damaging	Het
Abcg5	A	T	17: 84,658,543	L635Q	probably damaging	Het
Acsl3	G	A	1: 78,692,127	D238N	probably damaging	Het
Adam32	A	T	8: 24,872,736	C558S	probably damaging	Het
Adamtsl4	C	T	3: 95,684,401	V126M	possibly damaging	Het
Apobec1	G	A	6: 122,578,929	P190S	probably damaging	Het
Bpifa2	T	G	2: 154,010,492	V96G	probably damaging	Het
Cacna1s	G	A	1: 136,095,791	V923I	possibly damaging	Het
Caprin2	A	C	6: 148,842,848	Y1026*	probably null	Het
Cdk8	T	G	5: 146,268,290	W34G	probably damaging	Het
Cdkn3	A	T	14: 46,762,601	Q28L	probably benign	Het
Cfap58	A	G	19: 47,983,518	E629G	probably damaging	Het
Chaf1b	T	A	16: 93,894,742	C255S	probably damaging	Het
Clcn4	A	G	7: 7,291,428	F445L	possibly damaging	Het
Cpne6	A	C	14: 55,513,241	I140L	probably benign	Het
Cyp2b23	C	A	7: 26,686,403	A10S	possibly damaging	Het
Eci3	G	T	13: 34,956,890	T103K	probably benign	Het
Eri3	T	A	4: 117,593,162	M253K	probably damaging	Het
Gm21103	C	T	14: 6,301,907	V169M	possibly damaging	Het
Gm35060	T	C	18: 32,458,754		probably null	Het
Gm6594	G	A	17: 82,539,468	A71T	probably benign	Het
Gns	T	C	10: 121,378,103	S228P	probably damaging	Het
Hbegf	A	T	18: 36,515,171	S46T	probably benign	Het
Hcn1	GCAACAACA	GCAACAACAACA	13: 117,975,760		probably benign	Het
Mcf2l	T	A	8: 13,007,875		probably null	Het
Nfasc	T	C	1: 132,596,582	D846G	probably benign	Het
Nt5dc2	A	G	14: 31,134,826	Y103C	probably damaging	Het
Osbpl9	C	T	4: 109,086,375	V147M	possibly damaging	Het
Pid1	T	C	1: 84,038,249	I146V	probably benign	Het
Rangap1	A	G	15: 81,718,900	I108T	probably benign	Het
Rbm12b1	T	C	4: 12,146,409	Y794H	probably damaging	Het
Rprd1b	T	C	2: 158,050,132	S192P	probably damaging	Het
Sacs	A	T	14: 61,210,717	D3404V	possibly damaging	Het
Setd5	G	T	6: 113,115,010	G264V	probably damaging	Het
Tagln2	A	T	1: 172,505,199	I18F	possibly damaging	Het
Ttc17	C	A	2: 94,374,564	V338F	probably damaging	Het
Xirp2	T	A	2: 67,508,699	M428K	possibly damaging	Het
Zfp503	A	T	14: 21,986,064	D261E	probably damaging	Het
Zfp784	T	C	7: 5,035,906	T218A	possibly damaging	Het
Zp3	A	C	5: 135,984,522	D236A	probably damaging	Het

Other mutations in Arel1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00928:Arel1	APN	12	84934162	missense	probably damaging	0.98
IGL01532:Arel1	APN	12	84934162	missense	possibly damaging	0.46
IGL01640:Arel1	APN	12	84920701	missense	probably damaging	1.00
IGL02522:Arel1	APN	12	84927910	missense	probably damaging	1.00
IGL02675:Arel1	APN	12	84930228	missense	probably damaging	1.00
IGL02867:Arel1	APN	12	84934323	missense	probably benign	0.01
IGL03231:Arel1	APN	12	84934310	missense	probably benign
R0244:Arel1	UTSW	12	84920693	missense	probably damaging	0.99
R0363:Arel1	UTSW	12	84934253	missense	probably damaging	1.00
R0538:Arel1	UTSW	12	84941837	missense	probably damaging	1.00
R1633:Arel1	UTSW	12	84926283	missense	probably damaging	1.00
R1965:Arel1	UTSW	12	84940399	critical splice acceptor site	probably null
R2161:Arel1	UTSW	12	84921256	critical splice donor site	probably null
R4691:Arel1	UTSW	12	84930249	splice site	probably null
R4958:Arel1	UTSW	12	84926304	missense	possibly damaging	0.89
R4999:Arel1	UTSW	12	84931767	missense	probably damaging	0.99
R5088:Arel1	UTSW	12	84924115	missense	probably damaging	1.00
R5154:Arel1	UTSW	12	84931773	missense	probably benign
R5939:Arel1	UTSW	12	84926292	missense	probably damaging	0.99
R5945:Arel1	UTSW	12	84926347	missense	probably benign	0.20
R6118:Arel1	UTSW	12	84941939	missense	possibly damaging	0.46
R6421:Arel1	UTSW	12	84934345	missense	probably damaging	1.00
R6458:Arel1	UTSW	12	84940385	missense	possibly damaging	0.87
R7290:Arel1	UTSW	12	84941945	missense	probably benign	0.08
R7490:Arel1	UTSW	12	84941911	missense	probably damaging	0.97
R7732:Arel1	UTSW	12	84927889	missense	probably benign	0.45
R7743:Arel1	UTSW	12	84940269	missense	probably damaging	1.00
R8021:Arel1	UTSW	12	84934958	missense	possibly damaging	0.47
X0066:Arel1	UTSW	12	84934382	missense	probably damaging	0.99
X0066:Arel1	UTSW	12	84943329	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- TAGGCCACATTTAAGCCACC -3'
(R):5'- CACAGGCAAAGACTTGTCCATG -3'

Sequencing Primer
(F):5'- CCAACTTCACAGTGATCTCATAGCG -3'
(R):5'- CGCTGTGTTTCTAAGACCAGAACTG -3'

Posted On

2020-06-30