Incidental Mutation 'R8083:Arel1'
ID629472
Institutional Source Beutler Lab
Gene Symbol Arel1
Ensembl Gene ENSMUSG00000042350
Gene Nameapoptosis resistant E3 ubiquitin protein ligase 1
Synonyms1110018G07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.523) question?
Stock #R8083 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location84918148-84970900 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84940362 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 93 (H93Q)
Ref Sequence ENSEMBL: ENSMUSP00000048780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043169] [ENSMUST00000163231] [ENSMUST00000163372] [ENSMUST00000165093] [ENSMUST00000165886] [ENSMUST00000167448] [ENSMUST00000169161]
Predicted Effect probably benign
Transcript: ENSMUST00000043169
AA Change: H93Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000048780
Gene: ENSMUSG00000042350
AA Change: H93Q

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
IG_FLMN 56 160 4.53e-2 SMART
low complexity region 346 360 N/A INTRINSIC
Blast:HECTc 401 474 6e-39 BLAST
HECTc 481 823 1.04e-158 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163231
AA Change: H93Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129213
Gene: ENSMUSG00000042350
AA Change: H93Q

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
IG_FLMN 56 160 4.53e-2 SMART
low complexity region 346 360 N/A INTRINSIC
Blast:HECTc 386 474 1e-51 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163372
SMART Domains Protein: ENSMUSP00000130259
Gene: ENSMUSG00000042350

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Blast:IG_FLMN 56 81 7e-13 BLAST
SCOP:d1qfha1 56 81 4e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165093
SMART Domains Protein: ENSMUSP00000129147
Gene: ENSMUSG00000042350

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165886
SMART Domains Protein: ENSMUSP00000126508
Gene: ENSMUSG00000042350

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167448
SMART Domains Protein: ENSMUSP00000127426
Gene: ENSMUSG00000042350

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169161
AA Change: H93Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000126523
Gene: ENSMUSG00000042350
AA Change: H93Q

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
IG_FLMN 56 160 4.53e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A G 2: 152,441,067 E255G possibly damaging Het
Abcg5 A T 17: 84,658,543 L635Q probably damaging Het
Acsl3 G A 1: 78,692,127 D238N probably damaging Het
Adam32 A T 8: 24,872,736 C558S probably damaging Het
Adamtsl4 C T 3: 95,684,401 V126M possibly damaging Het
Apobec1 G A 6: 122,578,929 P190S probably damaging Het
Bpifa2 T G 2: 154,010,492 V96G probably damaging Het
Cacna1s G A 1: 136,095,791 V923I possibly damaging Het
Caprin2 A C 6: 148,842,848 Y1026* probably null Het
Cdk8 T G 5: 146,268,290 W34G probably damaging Het
Cdkn3 A T 14: 46,762,601 Q28L probably benign Het
Cfap58 A G 19: 47,983,518 E629G probably damaging Het
Chaf1b T A 16: 93,894,742 C255S probably damaging Het
Clcn4 A G 7: 7,291,428 F445L possibly damaging Het
Cpne6 A C 14: 55,513,241 I140L probably benign Het
Cyp2b23 C A 7: 26,686,403 A10S possibly damaging Het
Eci3 G T 13: 34,956,890 T103K probably benign Het
Eri3 T A 4: 117,593,162 M253K probably damaging Het
Gm21103 C T 14: 6,301,907 V169M possibly damaging Het
Gm35060 T C 18: 32,458,754 probably null Het
Gm6594 G A 17: 82,539,468 A71T probably benign Het
Gns T C 10: 121,378,103 S228P probably damaging Het
Hbegf A T 18: 36,515,171 S46T probably benign Het
Hcn1 GCAACAACA GCAACAACAACA 13: 117,975,760 probably benign Het
Mcf2l T A 8: 13,007,875 probably null Het
Nfasc T C 1: 132,596,582 D846G probably benign Het
Nt5dc2 A G 14: 31,134,826 Y103C probably damaging Het
Osbpl9 C T 4: 109,086,375 V147M possibly damaging Het
Pid1 T C 1: 84,038,249 I146V probably benign Het
Rangap1 A G 15: 81,718,900 I108T probably benign Het
Rbm12b1 T C 4: 12,146,409 Y794H probably damaging Het
Rprd1b T C 2: 158,050,132 S192P probably damaging Het
Sacs A T 14: 61,210,717 D3404V possibly damaging Het
Setd5 G T 6: 113,115,010 G264V probably damaging Het
Tagln2 A T 1: 172,505,199 I18F possibly damaging Het
Ttc17 C A 2: 94,374,564 V338F probably damaging Het
Xirp2 T A 2: 67,508,699 M428K possibly damaging Het
Zfp503 A T 14: 21,986,064 D261E probably damaging Het
Zfp784 T C 7: 5,035,906 T218A possibly damaging Het
Zp3 A C 5: 135,984,522 D236A probably damaging Het
Other mutations in Arel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Arel1 APN 12 84934162 missense probably damaging 0.98
IGL01532:Arel1 APN 12 84934162 missense possibly damaging 0.46
IGL01640:Arel1 APN 12 84920701 missense probably damaging 1.00
IGL02522:Arel1 APN 12 84927910 missense probably damaging 1.00
IGL02675:Arel1 APN 12 84930228 missense probably damaging 1.00
IGL02867:Arel1 APN 12 84934323 missense probably benign 0.01
IGL03231:Arel1 APN 12 84934310 missense probably benign
R0244:Arel1 UTSW 12 84920693 missense probably damaging 0.99
R0363:Arel1 UTSW 12 84934253 missense probably damaging 1.00
R0538:Arel1 UTSW 12 84941837 missense probably damaging 1.00
R1633:Arel1 UTSW 12 84926283 missense probably damaging 1.00
R1965:Arel1 UTSW 12 84940399 critical splice acceptor site probably null
R2161:Arel1 UTSW 12 84921256 critical splice donor site probably null
R4691:Arel1 UTSW 12 84930249 splice site probably null
R4958:Arel1 UTSW 12 84926304 missense possibly damaging 0.89
R4999:Arel1 UTSW 12 84931767 missense probably damaging 0.99
R5088:Arel1 UTSW 12 84924115 missense probably damaging 1.00
R5154:Arel1 UTSW 12 84931773 missense probably benign
R5939:Arel1 UTSW 12 84926292 missense probably damaging 0.99
R5945:Arel1 UTSW 12 84926347 missense probably benign 0.20
R6118:Arel1 UTSW 12 84941939 missense possibly damaging 0.46
R6421:Arel1 UTSW 12 84934345 missense probably damaging 1.00
R6458:Arel1 UTSW 12 84940385 missense possibly damaging 0.87
R7290:Arel1 UTSW 12 84941945 missense probably benign 0.08
R7490:Arel1 UTSW 12 84941911 missense probably damaging 0.97
R7732:Arel1 UTSW 12 84927889 missense probably benign 0.45
R7743:Arel1 UTSW 12 84940269 missense probably damaging 1.00
R8021:Arel1 UTSW 12 84934958 missense possibly damaging 0.47
X0066:Arel1 UTSW 12 84934382 missense probably damaging 0.99
X0066:Arel1 UTSW 12 84943329 splice site probably null
Predicted Primers PCR Primer
(F):5'- TAGGCCACATTTAAGCCACC -3'
(R):5'- CACAGGCAAAGACTTGTCCATG -3'

Sequencing Primer
(F):5'- CCAACTTCACAGTGATCTCATAGCG -3'
(R):5'- CGCTGTGTTTCTAAGACCAGAACTG -3'
Posted On2020-06-30