Incidental Mutation 'R8084:Prkag3'
ID629491
Institutional Source Beutler Lab
Gene Symbol Prkag3
Ensembl Gene ENSMUSG00000006542
Gene Nameprotein kinase, AMP-activated, gamma 3 non-catalytic subunit
SynonymsAMPKg3L, AMPKg3, AMPKg3S
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R8084 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location74738922-74749221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74747207 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 193 (C193Y)
Ref Sequence ENSEMBL: ENSMUSP00000080342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081636] [ENSMUST00000113672] [ENSMUST00000159728] [ENSMUST00000160732] [ENSMUST00000162093] [ENSMUST00000188073]
Predicted Effect probably damaging
Transcript: ENSMUST00000081636
AA Change: C193Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080342
Gene: ENSMUSG00000006542
AA Change: C193Y

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113672
AA Change: C168Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109302
Gene: ENSMUSG00000006542
AA Change: C168Y

DomainStartEndE-ValueType
low complexity region 38 52 N/A INTRINSIC
CBS 177 226 2.66e-6 SMART
CBS 258 307 7.57e-11 SMART
CBS 333 381 8.69e-11 SMART
CBS 405 453 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159728
Predicted Effect probably damaging
Transcript: ENSMUST00000160732
AA Change: C193Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125344
Gene: ENSMUSG00000006542
AA Change: C193Y

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162093
AA Change: C193Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125242
Gene: ENSMUSG00000006542
AA Change: C193Y

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188073
AA Change: C193Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139909
Gene: ENSMUSG00000006542
AA Change: C193Y

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit is one of the gamma regulatory subunits of AMPK. It is dominantly expressed in skeletal muscle. Studies of the pig counterpart suggest that this subunit may play a key role in the regulation of energy metabolism in skeletal muscle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display impaired glycogen synthesis after exercise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik T C 11: 59,208,571 L48P probably damaging Het
Abca2 T A 2: 25,433,967 Y190N probably benign Het
Acsl3 G A 1: 78,692,127 D238N probably damaging Het
Acss1 T A 2: 150,642,781 I181F probably damaging Het
Ano5 A G 7: 51,579,539 I610V probably benign Het
Anxa6 A T 11: 55,004,008 F256I probably damaging Het
Ash2l A G 8: 25,831,294 S273P probably benign Het
Baz2b T G 2: 59,962,236 E516A probably benign Het
Bbs2 G T 8: 94,087,428 D187E probably damaging Het
Cacna1b T A 2: 24,685,796 M747L probably benign Het
Cacna2d4 C A 6: 119,300,352 D675E probably damaging Het
Calcr G A 6: 3,687,615 T461M probably benign Het
Catip A G 1: 74,364,356 K126E probably damaging Het
Chga T C 12: 102,562,069 I273T probably benign Het
Clasp2 G A 9: 113,847,755 V185I probably benign Het
Cracr2a A G 6: 127,639,172 N370S probably benign Het
Crygc A T 1: 65,071,822 V102D probably benign Het
Ddx23 A G 15: 98,658,264 S58P unknown Het
Dlgap5 C T 14: 47,407,841 G281D probably benign Het
Dnah5 A T 15: 28,387,953 Y3186F probably damaging Het
Dpp6 A C 5: 27,631,399 I296L probably benign Het
Elfn2 C T 15: 78,672,460 R629H probably damaging Het
Eml2 G T 7: 19,181,224 probably null Het
Fitm1 T A 14: 55,576,449 V134E probably damaging Het
Flnb A G 14: 7,907,243 N1272S probably benign Het
Fuca1 G A 4: 135,934,803 W347* probably null Het
Gls2 G A 10: 128,199,256 R86H probably damaging Het
Grin2b T C 6: 135,733,488 K1020R probably benign Het
H2-DMb1 T A 17: 34,157,353 W149R probably damaging Het
Herc1 T A 9: 66,475,935 S3629R probably benign Het
Itih4 A T 14: 30,899,443 N821I possibly damaging Het
Kmt2d A T 15: 98,842,064 L4731Q unknown Het
Loxhd1 A T 18: 77,340,149 I472F possibly damaging Het
Lrp2 C A 2: 69,509,369 C1066F probably damaging Het
Mllt10 T A 2: 18,109,826 F114I probably damaging Het
Mpp5 A T 12: 78,820,851 Q336L probably benign Het
N4bp1 T C 8: 86,861,008 E434G probably benign Het
N6amt1 T C 16: 87,354,340 F30L probably damaging Het
Naca G A 10: 128,041,531 V811I unknown Het
Nobox A C 6: 43,305,167 I324S possibly damaging Het
Nup210l T C 3: 90,136,058 S442P probably benign Het
Olfr791 A T 10: 129,526,940 T238S probably damaging Het
Osbpl1a A T 18: 12,905,042 L284Q probably damaging Het
Pcdhb20 A C 18: 37,506,173 Y584S possibly damaging Het
Pgpep1l A T 7: 68,237,771 F27Y probably benign Het
Pik3cg T G 12: 32,195,688 I854L probably benign Het
Pot1a C T 6: 25,771,536 V229M possibly damaging Het
Prh1 C T 6: 132,571,859 P110S unknown Het
Prl2c5 T C 13: 13,185,954 F69L probably benign Het
Ptprq T C 10: 107,608,433 T1437A probably benign Het
Rabgap1 T C 2: 37,537,305 Y633H probably damaging Het
Rad54l2 G A 9: 106,713,502 T475I possibly damaging Het
Retreg1 C A 15: 25,969,799 A130E probably benign Het
Rps6kb1 G T 11: 86,535,436 H56N probably benign Het
Sars2 A G 7: 28,750,285 H385R probably damaging Het
Sbpl T G 17: 23,953,270 N225T unknown Het
Scml4 T C 10: 42,930,606 probably null Het
Scrib G A 15: 76,066,091 T302M probably benign Het
Sdk2 G A 11: 113,827,089 T1483I possibly damaging Het
Sh3bgrl3 A G 4: 134,128,079 S19P probably damaging Het
Slc10a6 C T 5: 103,612,461 V223I probably benign Het
Slc4a3 A G 1: 75,555,945 T950A probably benign Het
Spats2 A T 15: 99,167,080 D9V possibly damaging Het
Sphk1 A T 11: 116,535,078 probably null Het
Tex10 A T 4: 48,431,066 S897R probably benign Het
Tmco3 T C 8: 13,303,873 V395A probably damaging Het
Ttc7b A G 12: 100,384,173 L478P probably damaging Het
Ubac2 T C 14: 121,983,305 M184T probably benign Het
Wdr95 T C 5: 149,588,133 S433P probably damaging Het
Zfp202 T A 9: 40,211,242 H433Q probably benign Het
Zfp526 G T 7: 25,225,312 R332L probably damaging Het
Other mutations in Prkag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02085:Prkag3 APN 1 74748812 splice site probably benign
IGL02139:Prkag3 APN 1 74740724 missense probably benign 0.14
P0023:Prkag3 UTSW 1 74740739 missense probably damaging 1.00
R0002:Prkag3 UTSW 1 74744788 missense probably damaging 1.00
R0002:Prkag3 UTSW 1 74744788 missense probably damaging 1.00
R0256:Prkag3 UTSW 1 74741171 missense probably benign 0.01
R0547:Prkag3 UTSW 1 74744720 critical splice donor site probably null
R1314:Prkag3 UTSW 1 74747184 missense probably damaging 1.00
R1484:Prkag3 UTSW 1 74740760 missense probably damaging 1.00
R2842:Prkag3 UTSW 1 74741175 missense probably benign 0.30
R4739:Prkag3 UTSW 1 74740705 makesense probably null
R5159:Prkag3 UTSW 1 74741487 missense probably damaging 1.00
R5876:Prkag3 UTSW 1 74748816 critical splice donor site probably benign
R5989:Prkag3 UTSW 1 74741274 missense probably benign 0.00
R7444:Prkag3 UTSW 1 74747266 missense probably benign 0.00
R7553:Prkag3 UTSW 1 74744735 missense probably damaging 1.00
R7630:Prkag3 UTSW 1 74744735 missense probably damaging 1.00
R8115:Prkag3 UTSW 1 74747959 missense possibly damaging 0.49
Z1177:Prkag3 UTSW 1 74748025 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CACAGCATGCTCTCTTAGTACTG -3'
(R):5'- TGACCTGGAGCTGACCATAGAG -3'

Sequencing Primer
(F):5'- TGTGTATGATGCTAAGAAGGAGTCC -3'
(R):5'- GAGCTGACCATAGAGTTCCCAG -3'
Posted On2020-06-30