Incidental Mutation 'R8084:Cacna1b'
ID629495
Institutional Source Beutler Lab
Gene Symbol Cacna1b
Ensembl Gene ENSMUSG00000004113
Gene Namecalcium channel, voltage-dependent, N type, alpha 1B subunit
Synonymsalpha(1B), Cav2.2, Cchn1a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8084 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location24603887-24763152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24685796 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 747 (M747L)
Ref Sequence ENSEMBL: ENSMUSP00000037416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041342] [ENSMUST00000070864] [ENSMUST00000100348] [ENSMUST00000102939] [ENSMUST00000114447] [ENSMUST00000124183]
Predicted Effect probably benign
Transcript: ENSMUST00000041342
AA Change: M747L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000037416
Gene: ENSMUSG00000004113
AA Change: M747L

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.2e-57 PFAM
PDB:4DEX|B 358 467 8e-66 PDB
Pfam:Ion_trans 516 708 1.1e-47 PFAM
Pfam:PKD_channel 569 715 2.3e-7 PFAM
low complexity region 728 739 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
low complexity region 916 933 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:Ion_trans 1174 1408 2.7e-52 PFAM
Pfam:Ion_trans 1498 1698 1.2e-59 PFAM
Pfam:PKD_channel 1551 1705 8.1e-9 PFAM
Ca_chan_IQ 1837 1871 1.09e-11 SMART
low complexity region 2040 2050 N/A INTRINSIC
low complexity region 2092 2114 N/A INTRINSIC
low complexity region 2276 2292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070864
AA Change: M747L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063236
Gene: ENSMUSG00000004113
AA Change: M747L

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.4e-57 PFAM
PDB:4DEX|B 358 467 8e-66 PDB
Pfam:Ion_trans 516 708 1.2e-47 PFAM
Pfam:PKD_channel 569 715 1.5e-7 PFAM
low complexity region 728 739 N/A INTRINSIC
low complexity region 848 857 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 915 932 N/A INTRINSIC
low complexity region 1090 1101 N/A INTRINSIC
Pfam:Ion_trans 1173 1403 1.8e-52 PFAM
Pfam:Ion_trans 1493 1695 5.4e-60 PFAM
Pfam:PKD_channel 1544 1702 4.9e-9 PFAM
Ca_chan_IQ 1798 1832 7.2e-12 SMART
low complexity region 2001 2011 N/A INTRINSIC
low complexity region 2053 2075 N/A INTRINSIC
low complexity region 2237 2253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100348
AA Change: M748L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097920
Gene: ENSMUSG00000004113
AA Change: M748L

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.4e-57 PFAM
PDB:4DEX|B 358 468 5e-68 PDB
Pfam:Ion_trans 517 709 1.2e-47 PFAM
Pfam:PKD_channel 570 716 1.6e-7 PFAM
low complexity region 729 740 N/A INTRINSIC
low complexity region 850 859 N/A INTRINSIC
low complexity region 904 914 N/A INTRINSIC
low complexity region 917 934 N/A INTRINSIC
low complexity region 1092 1103 N/A INTRINSIC
Pfam:Ion_trans 1175 1409 3.2e-52 PFAM
Pfam:Ion_trans 1499 1699 1.4e-59 PFAM
Pfam:PKD_channel 1552 1706 5.6e-9 PFAM
Ca_chan_IQ 1838 1872 1.09e-11 SMART
low complexity region 2041 2051 N/A INTRINSIC
low complexity region 2093 2115 N/A INTRINSIC
low complexity region 2277 2293 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102939
AA Change: M747L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100003
Gene: ENSMUSG00000004113
AA Change: M747L

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.4e-57 PFAM
PDB:4DEX|B 358 467 1e-65 PDB
Pfam:Ion_trans 516 708 1.2e-47 PFAM
Pfam:PKD_channel 569 715 1.6e-7 PFAM
low complexity region 728 739 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
low complexity region 916 933 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:Ion_trans 1174 1404 1.9e-52 PFAM
Pfam:Ion_trans 1494 1696 5.5e-60 PFAM
Pfam:PKD_channel 1545 1703 5e-9 PFAM
Ca_chan_IQ 1835 1869 1.09e-11 SMART
low complexity region 2038 2048 N/A INTRINSIC
low complexity region 2090 2112 N/A INTRINSIC
low complexity region 2274 2290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114447
AA Change: M748L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110090
Gene: ENSMUSG00000004113
AA Change: M748L

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 94 367 8.5e-69 PFAM
Pfam:Ion_trans 482 721 2.4e-57 PFAM
Pfam:PKD_channel 571 715 1e-7 PFAM
low complexity region 729 740 N/A INTRINSIC
low complexity region 850 859 N/A INTRINSIC
low complexity region 904 914 N/A INTRINSIC
low complexity region 917 934 N/A INTRINSIC
low complexity region 1092 1103 N/A INTRINSIC
Pfam:Ion_trans 1139 1421 1.3e-62 PFAM
Pfam:Ion_trans 1464 1711 3.2e-64 PFAM
Pfam:PKD_channel 1550 1706 2.7e-9 PFAM
Pfam:GPHH 1713 1783 1.9e-39 PFAM
Ca_chan_IQ 1838 1872 1.09e-11 SMART
low complexity region 2041 2051 N/A INTRINSIC
low complexity region 2093 2115 N/A INTRINSIC
low complexity region 2277 2293 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124183
AA Change: M25L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114605
Gene: ENSMUSG00000004113
AA Change: M25L

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 44 60 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.2%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the pore-forming subunit of an N-type voltage-dependent calcium channel, which controls neurotransmitter release from neurons. The encoded protein forms a complex with alpha-2, beta, and delta subunits to form the high-voltage activated channel. This channel is sensitive to omega-conotoxin-GVIA and omega-agatoxin-IIIA but insensitive to dihydropyridines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice deficient in this gene exhibit defects in nociception, memory and learning. They also exhibit hyperactive and hyperaggressive behaviors as well as defects in the the sleep-wake cycle. Deficits in the sympathetic nervous system results in defects in circulatory regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T A 2: 25,433,967 Y190N probably benign Het
Acsl3 G A 1: 78,692,127 D238N probably damaging Het
Acss1 T A 2: 150,642,781 I181F probably damaging Het
Ano5 A G 7: 51,579,539 I610V probably benign Het
Anxa6 A T 11: 55,004,008 F256I probably damaging Het
Ash2l A G 8: 25,831,294 S273P probably benign Het
Baz2b T G 2: 59,962,236 E516A probably benign Het
Bbs2 G T 8: 94,087,428 D187E probably damaging Het
Cacna2d4 C A 6: 119,300,352 D675E probably damaging Het
Calcr G A 6: 3,687,615 T461M probably benign Het
Catip A G 1: 74,364,356 K126E probably damaging Het
Chga T C 12: 102,562,069 I273T probably benign Het
Clasp2 G A 9: 113,847,755 V185I probably benign Het
Cracr2a A G 6: 127,639,172 N370S probably benign Het
Crygc A T 1: 65,071,822 V102D probably benign Het
Ddx23 A G 15: 98,658,264 S58P unknown Het
Dlgap5 C T 14: 47,407,841 G281D probably benign Het
Dnah5 A T 15: 28,387,953 Y3186F probably damaging Het
Dpp6 A C 5: 27,631,399 I296L probably benign Het
Elfn2 C T 15: 78,672,460 R629H probably damaging Het
Eml2 G T 7: 19,181,224 probably null Het
Fitm1 T A 14: 55,576,449 V134E probably damaging Het
Flnb A G 14: 7,907,243 N1272S probably benign Het
Fuca1 G A 4: 135,934,803 W347* probably null Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gls2 G A 10: 128,199,256 R86H probably damaging Het
Grin2b T C 6: 135,733,488 K1020R probably benign Het
H2-DMb1 T A 17: 34,157,353 W149R probably damaging Het
Herc1 T A 9: 66,475,935 S3629R probably benign Het
Itih4 A T 14: 30,899,443 N821I possibly damaging Het
Kmt2d A T 15: 98,842,064 L4731Q unknown Het
Loxhd1 A T 18: 77,340,149 I472F possibly damaging Het
Lrp2 C A 2: 69,509,369 C1066F probably damaging Het
Mllt10 T A 2: 18,109,826 F114I probably damaging Het
Mpp5 A T 12: 78,820,851 Q336L probably benign Het
N4bp1 T C 8: 86,861,008 E434G probably benign Het
N6amt1 T C 16: 87,354,340 F30L probably damaging Het
Naca G A 10: 128,041,531 V811I unknown Het
Nobox A C 6: 43,305,167 I324S possibly damaging Het
Nup210l T C 3: 90,136,058 S442P probably benign Het
Olfr791 A T 10: 129,526,940 T238S probably damaging Het
Osbpl1a A T 18: 12,905,042 L284Q probably damaging Het
Pcdhb20 A C 18: 37,506,173 Y584S possibly damaging Het
Pgpep1l A T 7: 68,237,771 F27Y probably benign Het
Pik3cg T G 12: 32,195,688 I854L probably benign Het
Pot1a C T 6: 25,771,536 V229M possibly damaging Het
Prh1 C T 6: 132,571,859 P110S unknown Het
Prkag3 C T 1: 74,747,207 C193Y probably damaging Het
Prl2c5 T C 13: 13,185,954 F69L probably benign Het
Ptprq T C 10: 107,608,433 T1437A probably benign Het
Rabgap1 T C 2: 37,537,305 Y633H probably damaging Het
Rad54l2 G A 9: 106,713,502 T475I possibly damaging Het
Retreg1 C A 15: 25,969,799 A130E probably benign Het
Rps6kb1 G T 11: 86,535,436 H56N probably benign Het
Sars2 A G 7: 28,750,285 H385R probably damaging Het
Sbpl T G 17: 23,953,270 N225T unknown Het
Scml4 T C 10: 42,930,606 probably null Het
Scrib G A 15: 76,066,091 T302M probably benign Het
Sdk2 G A 11: 113,827,089 T1483I possibly damaging Het
Sh3bgrl3 A G 4: 134,128,079 S19P probably damaging Het
Slc10a6 C T 5: 103,612,461 V223I probably benign Het
Slc4a3 A G 1: 75,555,945 T950A probably benign Het
Spats2 A T 15: 99,167,080 D9V possibly damaging Het
Sphk1 A T 11: 116,535,078 probably null Het
Tex10 A T 4: 48,431,066 S897R probably benign Het
Tmco3 T C 8: 13,303,873 V395A probably damaging Het
Ttc7b A G 12: 100,384,173 L478P probably damaging Het
Ubac2 T C 14: 121,983,305 M184T probably benign Het
Wdr95 T C 5: 149,588,133 S433P probably damaging Het
Zfp202 T A 9: 40,211,242 H433Q probably benign Het
Zfp526 G T 7: 25,225,312 R332L probably damaging Het
Other mutations in Cacna1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cacna1b APN 2 24651200 nonsense probably null
IGL00508:Cacna1b APN 2 24657289 critical splice donor site probably null
IGL01085:Cacna1b APN 2 24678994 missense probably damaging 0.98
IGL01310:Cacna1b APN 2 24685782 missense probably damaging 1.00
IGL01361:Cacna1b APN 2 24679095 missense possibly damaging 0.49
IGL01471:Cacna1b APN 2 24657292 missense probably damaging 1.00
IGL01537:Cacna1b APN 2 24658528 missense probably damaging 1.00
IGL01547:Cacna1b APN 2 24632035 unclassified probably benign
IGL01750:Cacna1b APN 2 24654395 missense probably damaging 1.00
IGL01813:Cacna1b APN 2 24609890 missense probably damaging 1.00
IGL01939:Cacna1b APN 2 24661757 missense probably damaging 1.00
IGL01955:Cacna1b APN 2 24639137 missense probably damaging 1.00
IGL01972:Cacna1b APN 2 24635095 critical splice donor site probably null
IGL01987:Cacna1b APN 2 24697567 splice site probably null
IGL02096:Cacna1b APN 2 24678915 missense probably benign 0.01
IGL02111:Cacna1b APN 2 24606991 missense probably damaging 0.96
IGL02254:Cacna1b APN 2 24616815 splice site probably null
IGL03084:Cacna1b APN 2 24609932 missense probably benign
IGL03184:Cacna1b APN 2 24658489 critical splice donor site probably null
IGL03202:Cacna1b APN 2 24651112 missense probably damaging 1.00
IGL03210:Cacna1b APN 2 24650572 missense probably benign 0.00
IGL03402:Cacna1b APN 2 24762809 missense probably damaging 1.00
PIT4283001:Cacna1b UTSW 2 24631941 missense probably damaging 1.00
R0062:Cacna1b UTSW 2 24758331 missense probably damaging 1.00
R0062:Cacna1b UTSW 2 24758331 missense probably damaging 1.00
R0206:Cacna1b UTSW 2 24607480 missense probably damaging 1.00
R0208:Cacna1b UTSW 2 24607480 missense probably damaging 1.00
R0240:Cacna1b UTSW 2 24638657 unclassified probably benign
R0265:Cacna1b UTSW 2 24761844 missense probably damaging 1.00
R0352:Cacna1b UTSW 2 24625232 intron probably benign
R0376:Cacna1b UTSW 2 24659003 splice site probably benign
R0383:Cacna1b UTSW 2 24761844 missense probably damaging 1.00
R0432:Cacna1b UTSW 2 24687704 missense probably damaging 1.00
R0595:Cacna1b UTSW 2 24649989 splice site probably benign
R0660:Cacna1b UTSW 2 24654446 missense probably damaging 1.00
R0664:Cacna1b UTSW 2 24654446 missense probably damaging 1.00
R1107:Cacna1b UTSW 2 24697603 missense probably damaging 1.00
R1184:Cacna1b UTSW 2 24687745 splice site probably null
R1445:Cacna1b UTSW 2 24718136 splice site probably benign
R1446:Cacna1b UTSW 2 24706177 missense probably benign 0.01
R1496:Cacna1b UTSW 2 24678035 missense probably benign
R1614:Cacna1b UTSW 2 24690807 missense possibly damaging 0.88
R1626:Cacna1b UTSW 2 24606709 missense probably damaging 1.00
R1917:Cacna1b UTSW 2 24616879 missense probably null 0.80
R1984:Cacna1b UTSW 2 24648986 missense probably damaging 1.00
R1986:Cacna1b UTSW 2 24648986 missense probably damaging 1.00
R1989:Cacna1b UTSW 2 24721374 missense probably damaging 1.00
R1990:Cacna1b UTSW 2 24732306 missense probably damaging 1.00
R1991:Cacna1b UTSW 2 24732306 missense probably damaging 1.00
R1992:Cacna1b UTSW 2 24732306 missense probably damaging 1.00
R2098:Cacna1b UTSW 2 24650546 missense probably damaging 1.00
R2139:Cacna1b UTSW 2 24679473 missense probably benign 0.07
R2196:Cacna1b UTSW 2 24761788 missense probably damaging 1.00
R2229:Cacna1b UTSW 2 24685804 missense probably damaging 1.00
R2292:Cacna1b UTSW 2 24606620 missense probably benign 0.01
R2570:Cacna1b UTSW 2 24606637 nonsense probably null
R2850:Cacna1b UTSW 2 24761788 missense probably damaging 1.00
R2911:Cacna1b UTSW 2 24607541 splice site probably null
R2937:Cacna1b UTSW 2 24606528 missense probably benign 0.00
R2938:Cacna1b UTSW 2 24606528 missense probably benign 0.00
R3522:Cacna1b UTSW 2 24763043 missense possibly damaging 0.94
R3800:Cacna1b UTSW 2 24658959 missense probably benign 0.15
R4166:Cacna1b UTSW 2 24677911 missense probably benign 0.32
R4300:Cacna1b UTSW 2 24635239 missense probably damaging 1.00
R4366:Cacna1b UTSW 2 24702620 missense probably damaging 1.00
R4493:Cacna1b UTSW 2 24652938 missense probably damaging 0.99
R4494:Cacna1b UTSW 2 24652938 missense probably damaging 0.99
R4522:Cacna1b UTSW 2 24654430 missense probably damaging 1.00
R4612:Cacna1b UTSW 2 24626852 nonsense probably null
R4673:Cacna1b UTSW 2 24631944 missense probably damaging 1.00
R4703:Cacna1b UTSW 2 24654463 missense probably damaging 1.00
R4704:Cacna1b UTSW 2 24654463 missense probably damaging 1.00
R4777:Cacna1b UTSW 2 24732325 missense probably damaging 1.00
R4795:Cacna1b UTSW 2 24637487 missense possibly damaging 0.58
R4796:Cacna1b UTSW 2 24637487 missense possibly damaging 0.58
R4962:Cacna1b UTSW 2 24618318 missense probably damaging 1.00
R4962:Cacna1b UTSW 2 24657366 missense probably damaging 1.00
R4974:Cacna1b UTSW 2 24648523 missense probably damaging 0.99
R4990:Cacna1b UTSW 2 24678874 critical splice donor site probably null
R5109:Cacna1b UTSW 2 24690785 missense possibly damaging 0.88
R5117:Cacna1b UTSW 2 24732328 missense probably damaging 1.00
R5176:Cacna1b UTSW 2 24635131 missense probably damaging 1.00
R5253:Cacna1b UTSW 2 24719952 missense probably damaging 1.00
R5372:Cacna1b UTSW 2 24733959 missense probably damaging 1.00
R5374:Cacna1b UTSW 2 24706216 missense probably damaging 1.00
R5465:Cacna1b UTSW 2 24650426 critical splice donor site probably null
R5568:Cacna1b UTSW 2 24607600 missense probably damaging 1.00
R5580:Cacna1b UTSW 2 24650554 missense probably damaging 1.00
R5677:Cacna1b UTSW 2 24679358 missense possibly damaging 0.64
R6277:Cacna1b UTSW 2 24730796 missense probably damaging 1.00
R6294:Cacna1b UTSW 2 24719057 missense possibly damaging 0.94
R6609:Cacna1b UTSW 2 24653049 missense probably damaging 1.00
R6929:Cacna1b UTSW 2 24632010 missense probably damaging 1.00
R7016:Cacna1b UTSW 2 24762848 missense possibly damaging 0.77
R7112:Cacna1b UTSW 2 24690761 missense probably damaging 0.97
R7162:Cacna1b UTSW 2 24700022 missense probably benign 0.06
R7401:Cacna1b UTSW 2 24679294 missense probably benign 0.00
R7402:Cacna1b UTSW 2 24607659 missense probably benign 0.21
R7442:Cacna1b UTSW 2 24607501 missense probably benign
R7450:Cacna1b UTSW 2 24635135 nonsense probably null
R7481:Cacna1b UTSW 2 24616862 missense probably damaging 0.99
R7792:Cacna1b UTSW 2 24677965 missense probably damaging 0.99
R7999:Cacna1b UTSW 2 24650626 missense probably damaging 1.00
R8041:Cacna1b UTSW 2 24657299 missense probably damaging 1.00
R8147:Cacna1b UTSW 2 24679176 missense probably damaging 0.97
R8170:Cacna1b UTSW 2 24678874 critical splice donor site probably null
R8371:Cacna1b UTSW 2 24720024 missense possibly damaging 0.46
R8391:Cacna1b UTSW 2 24706200 missense probably damaging 1.00
R8723:Cacna1b UTSW 2 24658498 missense probably damaging 1.00
R8836:Cacna1b UTSW 2 24652970 missense possibly damaging 0.93
R8856:Cacna1b UTSW 2 24679518 missense probably benign 0.00
R8922:Cacna1b UTSW 2 24732328 missense possibly damaging 0.94
R8940:Cacna1b UTSW 2 24763072 unclassified probably benign
Z1088:Cacna1b UTSW 2 24661844 missense probably damaging 1.00
Z1088:Cacna1b UTSW 2 24733945 missense probably damaging 1.00
Z1176:Cacna1b UTSW 2 24626884 nonsense probably null
Z1177:Cacna1b UTSW 2 24638677 missense probably damaging 0.98
Z1177:Cacna1b UTSW 2 24661790 missense probably damaging 1.00
Z1177:Cacna1b UTSW 2 24678988 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CGTCATAAAGTATGCTCAGCCG -3'
(R):5'- TACACTCTGTCTACCTGGGAC -3'

Sequencing Primer
(F):5'- TCAGCCGAGCCCTTTGC -3'
(R):5'- ACCTGGATGTTTGCTCCAGAG -3'
Posted On2020-06-30