Incidental Mutation 'R8084:Nup210l'
ID 629501
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Name nucleoporin 210-like
Synonyms 4930548O11Rik
MMRRC Submission 067517-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.432) question?
Stock # R8084 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 90011439-90119355 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90043365 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 442 (S442P)
Ref Sequence ENSEMBL: ENSMUSP00000029548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
AlphaFold Q9D2F7
Predicted Effect probably benign
Transcript: ENSMUST00000029548
AA Change: S442P

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: S442P

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200410
AA Change: S442P

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: S442P

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.2%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T A 2: 25,323,979 (GRCm39) Y190N probably benign Het
Acsl3 G A 1: 78,669,844 (GRCm39) D238N probably damaging Het
Acss1 T A 2: 150,484,701 (GRCm39) I181F probably damaging Het
Ano5 A G 7: 51,229,287 (GRCm39) I610V probably benign Het
Anxa6 A T 11: 54,894,834 (GRCm39) F256I probably damaging Het
Ash2l A G 8: 26,321,322 (GRCm39) S273P probably benign Het
Baz2b T G 2: 59,792,580 (GRCm39) E516A probably benign Het
Bbs2 G T 8: 94,814,056 (GRCm39) D187E probably damaging Het
Cacna1b T A 2: 24,575,808 (GRCm39) M747L probably benign Het
Cacna2d4 C A 6: 119,277,313 (GRCm39) D675E probably damaging Het
Calcr G A 6: 3,687,615 (GRCm39) T461M probably benign Het
Catip A G 1: 74,403,515 (GRCm39) K126E probably damaging Het
Chga T C 12: 102,528,328 (GRCm39) I273T probably benign Het
Clasp2 G A 9: 113,676,823 (GRCm39) V185I probably benign Het
Cracr2a A G 6: 127,616,135 (GRCm39) N370S probably benign Het
Crygc A T 1: 65,110,981 (GRCm39) V102D probably benign Het
Ddx23 A G 15: 98,556,145 (GRCm39) S58P unknown Het
Dlgap5 C T 14: 47,645,298 (GRCm39) G281D probably benign Het
Dnah5 A T 15: 28,388,099 (GRCm39) Y3186F probably damaging Het
Dpp6 A C 5: 27,836,397 (GRCm39) I296L probably benign Het
Elfn2 C T 15: 78,556,660 (GRCm39) R629H probably damaging Het
Eml2 G T 7: 18,915,149 (GRCm39) probably null Het
Fitm1 T A 14: 55,813,906 (GRCm39) V134E probably damaging Het
Flnb A G 14: 7,907,243 (GRCm38) N1272S probably benign Het
Fuca1 G A 4: 135,662,114 (GRCm39) W347* probably null Het
Gabbr2 C T 4: 46,736,349 (GRCm39) probably null Het
Gls2 G A 10: 128,035,125 (GRCm39) R86H probably damaging Het
Grin2b T C 6: 135,710,486 (GRCm39) K1020R probably benign Het
H2-DMb1 T A 17: 34,376,327 (GRCm39) W149R probably damaging Het
Herc1 T A 9: 66,383,217 (GRCm39) S3629R probably benign Het
Itih4 A T 14: 30,621,400 (GRCm39) N821I possibly damaging Het
Kmt2d A T 15: 98,739,945 (GRCm39) L4731Q unknown Het
Loxhd1 A T 18: 77,427,845 (GRCm39) I472F possibly damaging Het
Lrp2 C A 2: 69,339,713 (GRCm39) C1066F probably damaging Het
Mllt10 T A 2: 18,114,637 (GRCm39) F114I probably damaging Het
N4bp1 T C 8: 87,587,636 (GRCm39) E434G probably benign Het
N6amt1 T C 16: 87,151,228 (GRCm39) F30L probably damaging Het
Naca G A 10: 127,877,400 (GRCm39) V811I unknown Het
Nobox A C 6: 43,282,101 (GRCm39) I324S possibly damaging Het
Or6c2 A T 10: 129,362,809 (GRCm39) T238S probably damaging Het
Osbpl1a A T 18: 13,038,099 (GRCm39) L284Q probably damaging Het
Pals1 A T 12: 78,867,625 (GRCm39) Q336L probably benign Het
Pcdhb20 A C 18: 37,639,226 (GRCm39) Y584S possibly damaging Het
Pgpep1l A T 7: 67,887,519 (GRCm39) F27Y probably benign Het
Pik3cg T G 12: 32,245,687 (GRCm39) I854L probably benign Het
Pot1a C T 6: 25,771,535 (GRCm39) V229M possibly damaging Het
Prh1 C T 6: 132,548,822 (GRCm39) P110S unknown Het
Prkag3 C T 1: 74,786,366 (GRCm39) C193Y probably damaging Het
Prl2c5 T C 13: 13,360,539 (GRCm39) F69L probably benign Het
Ptprq T C 10: 107,444,294 (GRCm39) T1437A probably benign Het
Rabgap1 T C 2: 37,427,317 (GRCm39) Y633H probably damaging Het
Rad54l2 G A 9: 106,590,701 (GRCm39) T475I possibly damaging Het
Retreg1 C A 15: 25,969,885 (GRCm39) A130E probably benign Het
Rps6kb1 G T 11: 86,426,262 (GRCm39) H56N probably benign Het
Sars2 A G 7: 28,449,710 (GRCm39) H385R probably damaging Het
Sbpl T G 17: 24,172,244 (GRCm39) N225T unknown Het
Scml4 T C 10: 42,806,602 (GRCm39) probably null Het
Scrib G A 15: 75,937,940 (GRCm39) T302M probably benign Het
Sdk2 G A 11: 113,717,915 (GRCm39) T1483I possibly damaging Het
Sh3bgrl3 A G 4: 133,855,390 (GRCm39) S19P probably damaging Het
Slc10a6 C T 5: 103,760,327 (GRCm39) V223I probably benign Het
Slc4a3 A G 1: 75,532,589 (GRCm39) T950A probably benign Het
Spats2 A T 15: 99,064,961 (GRCm39) D9V possibly damaging Het
Sphk1 A T 11: 116,425,904 (GRCm39) probably null Het
Tex10 A T 4: 48,431,066 (GRCm39) S897R probably benign Het
Tmco3 T C 8: 13,353,873 (GRCm39) V395A probably damaging Het
Ttc7b A G 12: 100,350,432 (GRCm39) L478P probably damaging Het
Ubac2 T C 14: 122,220,717 (GRCm39) M184T probably benign Het
Wdr95 T C 5: 149,511,598 (GRCm39) S433P probably damaging Het
Zfp202 T A 9: 40,122,538 (GRCm39) H433Q probably benign Het
Zfp526 G T 7: 24,924,737 (GRCm39) R332L probably damaging Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90,098,156 (GRCm39) splice site probably benign
IGL00813:Nup210l APN 3 90,039,725 (GRCm39) missense probably benign 0.00
IGL01375:Nup210l APN 3 90,067,200 (GRCm39) missense probably damaging 0.96
IGL01731:Nup210l APN 3 90,061,873 (GRCm39) missense probably damaging 1.00
IGL01786:Nup210l APN 3 90,030,083 (GRCm39) nonsense probably null
IGL01958:Nup210l APN 3 90,111,231 (GRCm39) missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90,087,520 (GRCm39) critical splice donor site probably null
IGL02120:Nup210l APN 3 90,044,169 (GRCm39) missense probably damaging 1.00
IGL02313:Nup210l APN 3 90,030,099 (GRCm39) missense probably damaging 1.00
IGL02336:Nup210l APN 3 90,088,859 (GRCm39) critical splice donor site probably null
IGL02348:Nup210l APN 3 90,011,471 (GRCm39) utr 5 prime probably benign
IGL02372:Nup210l APN 3 90,109,278 (GRCm39) missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90,031,537 (GRCm39) missense probably damaging 1.00
IGL02559:Nup210l APN 3 90,067,260 (GRCm39) missense probably benign 0.02
IGL02738:Nup210l APN 3 90,044,157 (GRCm39) missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90,096,852 (GRCm39) missense probably damaging 1.00
IGL03257:Nup210l APN 3 90,087,455 (GRCm39) critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90,077,351 (GRCm39) missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90,098,194 (GRCm39) missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R0040:Nup210l UTSW 3 90,089,212 (GRCm39) missense probably damaging 1.00
R0083:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0090:Nup210l UTSW 3 90,119,086 (GRCm39) missense probably benign 0.00
R0108:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0142:Nup210l UTSW 3 90,079,420 (GRCm39) missense probably damaging 1.00
R0306:Nup210l UTSW 3 90,114,675 (GRCm39) missense probably benign 0.13
R0332:Nup210l UTSW 3 90,039,616 (GRCm39) splice site probably benign
R0346:Nup210l UTSW 3 90,096,745 (GRCm39) missense probably damaging 1.00
R0463:Nup210l UTSW 3 90,087,518 (GRCm39) missense probably null 1.00
R0622:Nup210l UTSW 3 90,075,047 (GRCm39) missense probably damaging 0.98
R0765:Nup210l UTSW 3 90,027,184 (GRCm39) missense probably damaging 0.99
R0990:Nup210l UTSW 3 90,119,232 (GRCm39) missense probably benign 0.00
R1014:Nup210l UTSW 3 90,077,355 (GRCm39) missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90,100,247 (GRCm39) splice site probably benign
R1177:Nup210l UTSW 3 90,109,310 (GRCm39) missense probably benign 0.11
R1183:Nup210l UTSW 3 90,067,252 (GRCm39) missense probably benign 0.04
R1188:Nup210l UTSW 3 90,105,486 (GRCm39) missense probably benign 0.16
R1457:Nup210l UTSW 3 90,098,279 (GRCm39) missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90,077,869 (GRCm39) missense probably benign
R1627:Nup210l UTSW 3 90,051,476 (GRCm39) missense probably benign 0.15
R1778:Nup210l UTSW 3 90,096,793 (GRCm39) missense probably damaging 0.99
R1827:Nup210l UTSW 3 90,061,864 (GRCm39) missense probably damaging 1.00
R1843:Nup210l UTSW 3 90,079,393 (GRCm39) missense probably damaging 0.96
R1858:Nup210l UTSW 3 90,061,806 (GRCm39) missense probably damaging 0.97
R1942:Nup210l UTSW 3 90,058,544 (GRCm39) missense probably benign 0.01
R2015:Nup210l UTSW 3 90,092,739 (GRCm39) missense probably damaging 1.00
R2113:Nup210l UTSW 3 90,098,281 (GRCm39) missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90,088,852 (GRCm39) missense probably damaging 1.00
R3736:Nup210l UTSW 3 90,027,320 (GRCm39) missense probably damaging 1.00
R3740:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3741:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3742:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3771:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3773:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3879:Nup210l UTSW 3 90,092,780 (GRCm39) missense probably damaging 1.00
R3882:Nup210l UTSW 3 90,031,517 (GRCm39) missense probably benign 0.19
R3953:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R4290:Nup210l UTSW 3 90,114,633 (GRCm39) missense probably benign 0.00
R4328:Nup210l UTSW 3 90,083,142 (GRCm39) splice site probably null
R4629:Nup210l UTSW 3 90,098,181 (GRCm39) nonsense probably null
R4629:Nup210l UTSW 3 90,075,182 (GRCm39) missense probably benign 0.21
R4897:Nup210l UTSW 3 90,100,378 (GRCm39) missense probably damaging 1.00
R4906:Nup210l UTSW 3 90,077,337 (GRCm39) missense probably benign 0.06
R4966:Nup210l UTSW 3 90,014,208 (GRCm39) missense probably benign 0.00
R5004:Nup210l UTSW 3 90,087,472 (GRCm39) nonsense probably null
R5237:Nup210l UTSW 3 90,087,505 (GRCm39) missense probably benign 0.00
R5499:Nup210l UTSW 3 90,081,677 (GRCm39) missense probably damaging 1.00
R5522:Nup210l UTSW 3 90,061,972 (GRCm39) missense probably benign 0.10
R5627:Nup210l UTSW 3 90,051,557 (GRCm39) missense probably damaging 0.97
R5678:Nup210l UTSW 3 90,098,266 (GRCm39) missense probably damaging 0.99
R5726:Nup210l UTSW 3 90,036,514 (GRCm39) splice site probably null
R5792:Nup210l UTSW 3 90,107,164 (GRCm39) missense probably damaging 1.00
R6129:Nup210l UTSW 3 90,011,483 (GRCm39) missense probably benign 0.00
R6272:Nup210l UTSW 3 90,077,331 (GRCm39) missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90,027,216 (GRCm39) nonsense probably null
R6293:Nup210l UTSW 3 90,022,371 (GRCm39) missense probably damaging 1.00
R6446:Nup210l UTSW 3 90,079,375 (GRCm39) missense probably damaging 1.00
R6698:Nup210l UTSW 3 90,089,815 (GRCm39) missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90,044,231 (GRCm39) missense probably benign 0.01
R6895:Nup210l UTSW 3 90,067,231 (GRCm39) missense probably damaging 0.97
R6899:Nup210l UTSW 3 90,075,204 (GRCm39) missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90,061,873 (GRCm39) missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90,027,234 (GRCm39) missense probably benign 0.04
R7038:Nup210l UTSW 3 90,067,254 (GRCm39) missense probably damaging 1.00
R7273:Nup210l UTSW 3 90,025,854 (GRCm39) missense probably benign 0.04
R7450:Nup210l UTSW 3 90,022,495 (GRCm39) critical splice donor site probably null
R7514:Nup210l UTSW 3 90,117,766 (GRCm39) critical splice donor site probably null
R7658:Nup210l UTSW 3 90,119,300 (GRCm39) missense probably benign 0.43
R7735:Nup210l UTSW 3 90,092,883 (GRCm39) missense probably damaging 1.00
R7772:Nup210l UTSW 3 90,067,233 (GRCm39) missense probably damaging 1.00
R7800:Nup210l UTSW 3 90,041,904 (GRCm39) missense probably damaging 1.00
R7840:Nup210l UTSW 3 90,030,036 (GRCm39) missense probably benign 0.08
R7847:Nup210l UTSW 3 90,058,430 (GRCm39) missense probably benign
R7848:Nup210l UTSW 3 90,111,212 (GRCm39) missense probably benign 0.01
R8121:Nup210l UTSW 3 90,022,428 (GRCm39) missense probably damaging 1.00
R8421:Nup210l UTSW 3 90,111,174 (GRCm39) missense probably damaging 1.00
R8458:Nup210l UTSW 3 90,092,874 (GRCm39) missense probably null 1.00
R8701:Nup210l UTSW 3 90,030,121 (GRCm39) missense probably benign 0.41
R8720:Nup210l UTSW 3 90,117,681 (GRCm39) missense probably benign 0.00
R8770:Nup210l UTSW 3 90,025,850 (GRCm39) missense probably damaging 1.00
R8896:Nup210l UTSW 3 90,025,932 (GRCm39) missense probably damaging 1.00
R9033:Nup210l UTSW 3 90,105,396 (GRCm39) missense probably benign
R9371:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9373:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9381:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9426:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9427:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9501:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9523:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9574:Nup210l UTSW 3 90,117,693 (GRCm39) missense probably benign
R9612:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9654:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,105,402 (GRCm39) missense probably benign 0.30
R9662:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9682:Nup210l UTSW 3 90,051,469 (GRCm39) missense possibly damaging 0.79
R9729:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9750:Nup210l UTSW 3 90,117,659 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCCTGCATGAGCTGTACCTG -3'
(R):5'- TGCAGAGCTGTAACAACCTC -3'

Sequencing Primer
(F):5'- ATGAGCTGTACCTGCCTCTACAC -3'
(R):5'- CTACAGAGTTTAAGGCCAGCTTG -3'
Posted On 2020-06-30