Incidental Mutation 'R8084:Rad54l2'
ID629526
Institutional Source Beutler Lab
Gene Symbol Rad54l2
Ensembl Gene ENSMUSG00000040661
Gene NameRAD54 like 2 (S. cerevisiae)
SynonymsSrisnf2l, G630026H09Rik, Arip4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8084 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location106688082-106789194 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106713502 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 475 (T475I)
Ref Sequence ENSEMBL: ENSMUSP00000045454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046502]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046502
AA Change: T475I

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661
AA Change: T475I

DomainStartEndE-ValueType
coiled coil region 20 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 130 146 N/A INTRINSIC
low complexity region 186 200 N/A INTRINSIC
low complexity region 215 229 N/A INTRINSIC
DEXDc 267 520 4.21e-20 SMART
HELICc 751 854 1.88e-17 SMART
low complexity region 959 976 N/A INTRINSIC
low complexity region 1348 1368 N/A INTRINSIC
low complexity region 1453 1460 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.2%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T A 2: 25,433,967 Y190N probably benign Het
Acsl3 G A 1: 78,692,127 D238N probably damaging Het
Acss1 T A 2: 150,642,781 I181F probably damaging Het
Ano5 A G 7: 51,579,539 I610V probably benign Het
Anxa6 A T 11: 55,004,008 F256I probably damaging Het
Ash2l A G 8: 25,831,294 S273P probably benign Het
Baz2b T G 2: 59,962,236 E516A probably benign Het
Bbs2 G T 8: 94,087,428 D187E probably damaging Het
Cacna1b T A 2: 24,685,796 M747L probably benign Het
Cacna2d4 C A 6: 119,300,352 D675E probably damaging Het
Calcr G A 6: 3,687,615 T461M probably benign Het
Catip A G 1: 74,364,356 K126E probably damaging Het
Chga T C 12: 102,562,069 I273T probably benign Het
Clasp2 G A 9: 113,847,755 V185I probably benign Het
Cracr2a A G 6: 127,639,172 N370S probably benign Het
Crygc A T 1: 65,071,822 V102D probably benign Het
Ddx23 A G 15: 98,658,264 S58P unknown Het
Dlgap5 C T 14: 47,407,841 G281D probably benign Het
Dnah5 A T 15: 28,387,953 Y3186F probably damaging Het
Dpp6 A C 5: 27,631,399 I296L probably benign Het
Elfn2 C T 15: 78,672,460 R629H probably damaging Het
Eml2 G T 7: 19,181,224 probably null Het
Fitm1 T A 14: 55,576,449 V134E probably damaging Het
Flnb A G 14: 7,907,243 N1272S probably benign Het
Fuca1 G A 4: 135,934,803 W347* probably null Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gls2 G A 10: 128,199,256 R86H probably damaging Het
Grin2b T C 6: 135,733,488 K1020R probably benign Het
H2-DMb1 T A 17: 34,157,353 W149R probably damaging Het
Herc1 T A 9: 66,475,935 S3629R probably benign Het
Itih4 A T 14: 30,899,443 N821I possibly damaging Het
Kmt2d A T 15: 98,842,064 L4731Q unknown Het
Loxhd1 A T 18: 77,340,149 I472F possibly damaging Het
Lrp2 C A 2: 69,509,369 C1066F probably damaging Het
Mllt10 T A 2: 18,109,826 F114I probably damaging Het
Mpp5 A T 12: 78,820,851 Q336L probably benign Het
N4bp1 T C 8: 86,861,008 E434G probably benign Het
N6amt1 T C 16: 87,354,340 F30L probably damaging Het
Naca G A 10: 128,041,531 V811I unknown Het
Nobox A C 6: 43,305,167 I324S possibly damaging Het
Nup210l T C 3: 90,136,058 S442P probably benign Het
Olfr791 A T 10: 129,526,940 T238S probably damaging Het
Osbpl1a A T 18: 12,905,042 L284Q probably damaging Het
Pcdhb20 A C 18: 37,506,173 Y584S possibly damaging Het
Pgpep1l A T 7: 68,237,771 F27Y probably benign Het
Pik3cg T G 12: 32,195,688 I854L probably benign Het
Pot1a C T 6: 25,771,536 V229M possibly damaging Het
Prh1 C T 6: 132,571,859 P110S unknown Het
Prkag3 C T 1: 74,747,207 C193Y probably damaging Het
Prl2c5 T C 13: 13,185,954 F69L probably benign Het
Ptprq T C 10: 107,608,433 T1437A probably benign Het
Rabgap1 T C 2: 37,537,305 Y633H probably damaging Het
Retreg1 C A 15: 25,969,799 A130E probably benign Het
Rps6kb1 G T 11: 86,535,436 H56N probably benign Het
Sars2 A G 7: 28,750,285 H385R probably damaging Het
Sbpl T G 17: 23,953,270 N225T unknown Het
Scml4 T C 10: 42,930,606 probably null Het
Scrib G A 15: 76,066,091 T302M probably benign Het
Sdk2 G A 11: 113,827,089 T1483I possibly damaging Het
Sh3bgrl3 A G 4: 134,128,079 S19P probably damaging Het
Slc10a6 C T 5: 103,612,461 V223I probably benign Het
Slc4a3 A G 1: 75,555,945 T950A probably benign Het
Spats2 A T 15: 99,167,080 D9V possibly damaging Het
Sphk1 A T 11: 116,535,078 probably null Het
Tex10 A T 4: 48,431,066 S897R probably benign Het
Tmco3 T C 8: 13,303,873 V395A probably damaging Het
Ttc7b A G 12: 100,384,173 L478P probably damaging Het
Ubac2 T C 14: 121,983,305 M184T probably benign Het
Wdr95 T C 5: 149,588,133 S433P probably damaging Het
Zfp202 T A 9: 40,211,242 H433Q probably benign Het
Zfp526 G T 7: 25,225,312 R332L probably damaging Het
Other mutations in Rad54l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Rad54l2 APN 9 106700561 missense probably benign
IGL00718:Rad54l2 APN 9 106713455 missense probably damaging 1.00
IGL00917:Rad54l2 APN 9 106710439 missense possibly damaging 0.95
IGL01319:Rad54l2 APN 9 106719046 missense probably benign 0.18
IGL01447:Rad54l2 APN 9 106702772 missense probably damaging 1.00
IGL01469:Rad54l2 APN 9 106722758 missense probably damaging 1.00
IGL01836:Rad54l2 APN 9 106716157 missense probably benign 0.00
IGL02017:Rad54l2 APN 9 106754040 missense possibly damaging 0.85
IGL02179:Rad54l2 APN 9 106720390 missense probably damaging 1.00
IGL02348:Rad54l2 APN 9 106720376 missense probably damaging 1.00
IGL02822:Rad54l2 APN 9 106710407 missense probably damaging 1.00
IGL03169:Rad54l2 APN 9 106719064 missense probably benign 0.37
IGL03245:Rad54l2 APN 9 106703628 missense probably damaging 1.00
IGL03253:Rad54l2 APN 9 106704223 missense probably damaging 1.00
IGL02988:Rad54l2 UTSW 9 106700585 missense probably benign
PIT4495001:Rad54l2 UTSW 9 106716144 missense probably benign 0.02
R0001:Rad54l2 UTSW 9 106708217 missense probably damaging 0.97
R0069:Rad54l2 UTSW 9 106710365 missense possibly damaging 0.67
R0069:Rad54l2 UTSW 9 106710365 missense possibly damaging 0.67
R0114:Rad54l2 UTSW 9 106713455 missense probably damaging 1.00
R0427:Rad54l2 UTSW 9 106693692 missense possibly damaging 0.65
R0519:Rad54l2 UTSW 9 106708299 missense probably damaging 0.98
R0760:Rad54l2 UTSW 9 106719606 critical splice donor site probably null
R1018:Rad54l2 UTSW 9 106712390 missense probably benign 0.32
R1630:Rad54l2 UTSW 9 106703629 missense possibly damaging 0.79
R1701:Rad54l2 UTSW 9 106700493 critical splice donor site probably null
R1903:Rad54l2 UTSW 9 106693717 splice site probably null
R2187:Rad54l2 UTSW 9 106753992 small deletion probably benign
R2205:Rad54l2 UTSW 9 106717798 missense probably damaging 1.00
R2566:Rad54l2 UTSW 9 106703626 missense possibly damaging 0.95
R2983:Rad54l2 UTSW 9 106700590 missense probably benign 0.10
R3176:Rad54l2 UTSW 9 106753943 critical splice donor site probably null
R3276:Rad54l2 UTSW 9 106753943 critical splice donor site probably null
R3718:Rad54l2 UTSW 9 106693527 missense probably benign
R4063:Rad54l2 UTSW 9 106720414 missense probably benign 0.10
R4206:Rad54l2 UTSW 9 106717795 missense probably damaging 1.00
R4271:Rad54l2 UTSW 9 106693626 missense probably benign 0.22
R4377:Rad54l2 UTSW 9 106693222 missense probably benign 0.00
R4700:Rad54l2 UTSW 9 106754025 missense possibly damaging 0.85
R4729:Rad54l2 UTSW 9 106716118 missense probably benign
R4872:Rad54l2 UTSW 9 106717892 missense probably damaging 1.00
R4997:Rad54l2 UTSW 9 106722909 missense possibly damaging 0.70
R5475:Rad54l2 UTSW 9 106705858 missense probably damaging 1.00
R5658:Rad54l2 UTSW 9 106753992 small deletion probably benign
R6246:Rad54l2 UTSW 9 106700493 critical splice donor site probably null
R6248:Rad54l2 UTSW 9 106710338 missense probably damaging 1.00
R6329:Rad54l2 UTSW 9 106717922 missense possibly damaging 0.89
R6631:Rad54l2 UTSW 9 106713540 nonsense probably null
R6773:Rad54l2 UTSW 9 106693317 missense probably benign
R7148:Rad54l2 UTSW 9 106719119 nonsense probably null
R7171:Rad54l2 UTSW 9 106713478 missense probably damaging 1.00
R7226:Rad54l2 UTSW 9 106713472 missense probably damaging 0.99
R7327:Rad54l2 UTSW 9 106693461 missense possibly damaging 0.68
R7337:Rad54l2 UTSW 9 106705825 missense probably damaging 1.00
R7636:Rad54l2 UTSW 9 106720387 missense probably damaging 1.00
R7659:Rad54l2 UTSW 9 106713578 missense probably benign 0.11
R7713:Rad54l2 UTSW 9 106717223 missense probably damaging 1.00
R7748:Rad54l2 UTSW 9 106719034 missense possibly damaging 0.53
R8021:Rad54l2 UTSW 9 106719641 missense probably benign 0.00
R8552:Rad54l2 UTSW 9 106693578 missense possibly damaging 0.77
R8768:Rad54l2 UTSW 9 106719610 missense probably benign 0.04
R8952:Rad54l2 UTSW 9 106688851 unclassified probably benign
R8953:Rad54l2 UTSW 9 106693262 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCGTTTAGGATAGGGCGTTC -3'
(R):5'- GTAGGAGCTTATCTGGCTGC -3'

Sequencing Primer
(F):5'- GGGCGTTCAAACATGTTGCTAAAC -3'
(R):5'- CAATGGGGGCTGACTCTTGC -3'
Posted On2020-06-30