Incidental Mutation 'R8084:Pik3cg'
ID 629538
Institutional Source Beutler Lab
Gene Symbol Pik3cg
Ensembl Gene ENSMUSG00000020573
Gene Name phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma
Synonyms PI(3)Kgamma, p110gamma, 5830428L06Rik, PI3K, PI3Kgamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8084 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 32173473-32208659 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 32195688 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 854 (I854L)
Ref Sequence ENSEMBL: ENSMUSP00000062864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053215] [ENSMUST00000085469] [ENSMUST00000156904] [ENSMUST00000217915] [ENSMUST00000220366]
AlphaFold Q9JHG7
Predicted Effect probably benign
Transcript: ENSMUST00000053215
AA Change: I854L

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000062864
Gene: ENSMUSG00000020573
AA Change: I854L

DomainStartEndE-ValueType
PI3K_rbd 203 312 3.56e-43 SMART
PI3K_C2 349 452 1.15e-28 SMART
PI3Ka 541 733 4.41e-89 SMART
PI3Kc 829 1094 3.9e-131 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085469
AA Change: I854L

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000082596
Gene: ENSMUSG00000020573
AA Change: I854L

DomainStartEndE-ValueType
PI3K_rbd 203 312 3.56e-43 SMART
PI3K_C2 349 452 1.15e-28 SMART
PI3Ka 541 733 4.41e-89 SMART
PI3Kc 829 1094 3.9e-131 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156904
AA Change: I854L

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123539
Gene: ENSMUSG00000020573
AA Change: I854L

DomainStartEndE-ValueType
PI3K_rbd 203 312 3.56e-43 SMART
PI3K_C2 349 452 1.15e-28 SMART
PI3Ka 541 733 4.41e-89 SMART
PI3Kc 829 1094 3.9e-131 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217915
AA Change: I854L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000220366
AA Change: I854L

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.2%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I catalytic subunit of PI3K. Like other class I catalytic subunits (p110-alpha p110-beta, and p110-delta), the encoded protein binds a p85 regulatory subunit to form PI3K. This gene is located in a commonly deleted segment of chromosome 7 previously identified in myeloid leukemias. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in thymocyte development, T cell activation, and neutrophil migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T A 2: 25,433,967 Y190N probably benign Het
Acsl3 G A 1: 78,692,127 D238N probably damaging Het
Acss1 T A 2: 150,642,781 I181F probably damaging Het
Ano5 A G 7: 51,579,539 I610V probably benign Het
Anxa6 A T 11: 55,004,008 F256I probably damaging Het
Ash2l A G 8: 25,831,294 S273P probably benign Het
Baz2b T G 2: 59,962,236 E516A probably benign Het
Bbs2 G T 8: 94,087,428 D187E probably damaging Het
Cacna1b T A 2: 24,685,796 M747L probably benign Het
Cacna2d4 C A 6: 119,300,352 D675E probably damaging Het
Calcr G A 6: 3,687,615 T461M probably benign Het
Catip A G 1: 74,364,356 K126E probably damaging Het
Chga T C 12: 102,562,069 I273T probably benign Het
Clasp2 G A 9: 113,847,755 V185I probably benign Het
Cracr2a A G 6: 127,639,172 N370S probably benign Het
Crygc A T 1: 65,071,822 V102D probably benign Het
Ddx23 A G 15: 98,658,264 S58P unknown Het
Dlgap5 C T 14: 47,407,841 G281D probably benign Het
Dnah5 A T 15: 28,387,953 Y3186F probably damaging Het
Dpp6 A C 5: 27,631,399 I296L probably benign Het
Elfn2 C T 15: 78,672,460 R629H probably damaging Het
Eml2 G T 7: 19,181,224 probably null Het
Fitm1 T A 14: 55,576,449 V134E probably damaging Het
Flnb A G 14: 7,907,243 N1272S probably benign Het
Fuca1 G A 4: 135,934,803 W347* probably null Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gls2 G A 10: 128,199,256 R86H probably damaging Het
Grin2b T C 6: 135,733,488 K1020R probably benign Het
H2-DMb1 T A 17: 34,157,353 W149R probably damaging Het
Herc1 T A 9: 66,475,935 S3629R probably benign Het
Itih4 A T 14: 30,899,443 N821I possibly damaging Het
Kmt2d A T 15: 98,842,064 L4731Q unknown Het
Loxhd1 A T 18: 77,340,149 I472F possibly damaging Het
Lrp2 C A 2: 69,509,369 C1066F probably damaging Het
Mllt10 T A 2: 18,109,826 F114I probably damaging Het
Mpp5 A T 12: 78,820,851 Q336L probably benign Het
N4bp1 T C 8: 86,861,008 E434G probably benign Het
N6amt1 T C 16: 87,354,340 F30L probably damaging Het
Naca G A 10: 128,041,531 V811I unknown Het
Nobox A C 6: 43,305,167 I324S possibly damaging Het
Nup210l T C 3: 90,136,058 S442P probably benign Het
Olfr791 A T 10: 129,526,940 T238S probably damaging Het
Osbpl1a A T 18: 12,905,042 L284Q probably damaging Het
Pcdhb20 A C 18: 37,506,173 Y584S possibly damaging Het
Pgpep1l A T 7: 68,237,771 F27Y probably benign Het
Pot1a C T 6: 25,771,536 V229M possibly damaging Het
Prh1 C T 6: 132,571,859 P110S unknown Het
Prkag3 C T 1: 74,747,207 C193Y probably damaging Het
Prl2c5 T C 13: 13,185,954 F69L probably benign Het
Ptprq T C 10: 107,608,433 T1437A probably benign Het
Rabgap1 T C 2: 37,537,305 Y633H probably damaging Het
Rad54l2 G A 9: 106,713,502 T475I possibly damaging Het
Retreg1 C A 15: 25,969,799 A130E probably benign Het
Rps6kb1 G T 11: 86,535,436 H56N probably benign Het
Sars2 A G 7: 28,750,285 H385R probably damaging Het
Sbpl T G 17: 23,953,270 N225T unknown Het
Scml4 T C 10: 42,930,606 probably null Het
Scrib G A 15: 76,066,091 T302M probably benign Het
Sdk2 G A 11: 113,827,089 T1483I possibly damaging Het
Sh3bgrl3 A G 4: 134,128,079 S19P probably damaging Het
Slc10a6 C T 5: 103,612,461 V223I probably benign Het
Slc4a3 A G 1: 75,555,945 T950A probably benign Het
Spats2 A T 15: 99,167,080 D9V possibly damaging Het
Sphk1 A T 11: 116,535,078 probably null Het
Tex10 A T 4: 48,431,066 S897R probably benign Het
Tmco3 T C 8: 13,303,873 V395A probably damaging Het
Ttc7b A G 12: 100,384,173 L478P probably damaging Het
Ubac2 T C 14: 121,983,305 M184T probably benign Het
Wdr95 T C 5: 149,588,133 S433P probably damaging Het
Zfp202 T A 9: 40,211,242 H433Q probably benign Het
Zfp526 G T 7: 25,225,312 R332L probably damaging Het
Other mutations in Pik3cg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pik3cg APN 12 32205149 missense probably damaging 1.00
IGL02182:Pik3cg APN 12 32205273 missense possibly damaging 0.90
IGL02273:Pik3cg APN 12 32176810 missense probably damaging 1.00
IGL02312:Pik3cg APN 12 32194821 missense possibly damaging 0.55
IGL02752:Pik3cg APN 12 32204263 missense probably damaging 1.00
IGL03107:Pik3cg APN 12 32200595 missense probably damaging 1.00
IGL03139:Pik3cg APN 12 32192223 missense probably damaging 1.00
IGL03267:Pik3cg APN 12 32205308 missense possibly damaging 0.94
IGL03367:Pik3cg APN 12 32192121 missense probably benign 0.01
PIT4283001:Pik3cg UTSW 12 32205865 missense probably damaging 1.00
PIT4472001:Pik3cg UTSW 12 32204984 missense probably damaging 0.99
PIT4514001:Pik3cg UTSW 12 32204903 missense probably damaging 1.00
R0112:Pik3cg UTSW 12 32195715 splice site probably benign
R0145:Pik3cg UTSW 12 32204322 missense probably benign 0.20
R0279:Pik3cg UTSW 12 32204791 missense probably damaging 1.00
R0471:Pik3cg UTSW 12 32194771 missense probably damaging 0.99
R0494:Pik3cg UTSW 12 32204546 missense possibly damaging 0.84
R0573:Pik3cg UTSW 12 32197197 missense probably damaging 1.00
R0631:Pik3cg UTSW 12 32205203 missense probably benign
R0699:Pik3cg UTSW 12 32197342 splice site probably benign
R0826:Pik3cg UTSW 12 32195673 missense possibly damaging 0.78
R1076:Pik3cg UTSW 12 32195714 splice site probably benign
R1101:Pik3cg UTSW 12 32195646 missense probably null 0.98
R1459:Pik3cg UTSW 12 32204984 missense probably damaging 0.99
R1625:Pik3cg UTSW 12 32194742 missense probably damaging 1.00
R1971:Pik3cg UTSW 12 32192153 missense probably damaging 1.00
R1992:Pik3cg UTSW 12 32204025 missense possibly damaging 0.83
R2109:Pik3cg UTSW 12 32193710 missense possibly damaging 0.75
R2319:Pik3cg UTSW 12 32176736 missense probably damaging 0.99
R3421:Pik3cg UTSW 12 32204739 missense probably damaging 1.00
R3422:Pik3cg UTSW 12 32204739 missense probably damaging 1.00
R3740:Pik3cg UTSW 12 32205224 missense probably damaging 1.00
R3777:Pik3cg UTSW 12 32194709 missense probably damaging 0.98
R4300:Pik3cg UTSW 12 32176672 missense probably damaging 1.00
R4395:Pik3cg UTSW 12 32204092 missense probably damaging 1.00
R4725:Pik3cg UTSW 12 32193597 critical splice donor site probably null
R4785:Pik3cg UTSW 12 32205199 missense probably damaging 0.97
R4809:Pik3cg UTSW 12 32204081 missense possibly damaging 0.46
R4981:Pik3cg UTSW 12 32204104 missense possibly damaging 0.77
R5033:Pik3cg UTSW 12 32199196 splice site probably null
R5161:Pik3cg UTSW 12 32204978 missense possibly damaging 0.92
R5806:Pik3cg UTSW 12 32204953 missense possibly damaging 0.88
R6136:Pik3cg UTSW 12 32204359 missense probably benign 0.00
R6746:Pik3cg UTSW 12 32194758 missense probably damaging 1.00
R6895:Pik3cg UTSW 12 32204347 missense possibly damaging 0.87
R7000:Pik3cg UTSW 12 32192129 missense probably damaging 1.00
R7089:Pik3cg UTSW 12 32176846 missense probably benign 0.00
R7113:Pik3cg UTSW 12 32205667 missense probably damaging 0.98
R7372:Pik3cg UTSW 12 32197197 missense probably damaging 1.00
R7483:Pik3cg UTSW 12 32195648 missense probably damaging 0.99
R7596:Pik3cg UTSW 12 32204741 missense probably damaging 1.00
R7771:Pik3cg UTSW 12 32204014 missense probably benign
R7910:Pik3cg UTSW 12 32200517 missense probably benign 0.16
R7974:Pik3cg UTSW 12 32204032 missense probably benign 0.00
R8352:Pik3cg UTSW 12 32193640 missense probably damaging 1.00
R8452:Pik3cg UTSW 12 32193640 missense probably damaging 1.00
R8720:Pik3cg UTSW 12 32193689 missense probably benign 0.09
R8757:Pik3cg UTSW 12 32205007 missense probably damaging 1.00
R8911:Pik3cg UTSW 12 32197258 missense probably benign
R9052:Pik3cg UTSW 12 32195709 missense possibly damaging 0.91
R9166:Pik3cg UTSW 12 32192214 missense probably damaging 1.00
R9209:Pik3cg UTSW 12 32197313 missense probably damaging 0.99
Z1176:Pik3cg UTSW 12 32204795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAGTCTCTTTCCAGCCTG -3'
(R):5'- TTTCTGAGTATCAGTCTGAAGAGTG -3'

Sequencing Primer
(F):5'- GAGTCTCTTTCCAGCCTGGGAAC -3'
(R):5'- GAAAATGCATTGGCCAACA -3'
Posted On 2020-06-30