Incidental Mutation 'R8084:Ttc7b'
ID629540
Institutional Source Beutler Lab
Gene Symbol Ttc7b
Ensembl Gene ENSMUSG00000033530
Gene Nametetratricopeptide repeat domain 7B
SynonymsTtc7l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R8084 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location100300770-100520826 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100384173 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 478 (L478P)
Ref Sequence ENSEMBL: ENSMUSP00000052107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062957] [ENSMUST00000223020]
Predicted Effect probably damaging
Transcript: ENSMUST00000062957
AA Change: L478P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052107
Gene: ENSMUSG00000033530
AA Change: L478P

DomainStartEndE-ValueType
TPR 397 430 8.76e-1 SMART
Blast:TPR 471 514 5e-9 BLAST
TPR 515 548 2.77e1 SMART
TPR 549 582 2.01e0 SMART
TPR 696 729 9.7e0 SMART
TPR 730 763 7.98e-4 SMART
TPR 764 797 6.1e0 SMART
TPR 798 831 2.74e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223020
AA Change: L478P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.2%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T A 2: 25,433,967 Y190N probably benign Het
Acsl3 G A 1: 78,692,127 D238N probably damaging Het
Acss1 T A 2: 150,642,781 I181F probably damaging Het
Ano5 A G 7: 51,579,539 I610V probably benign Het
Anxa6 A T 11: 55,004,008 F256I probably damaging Het
Ash2l A G 8: 25,831,294 S273P probably benign Het
Baz2b T G 2: 59,962,236 E516A probably benign Het
Bbs2 G T 8: 94,087,428 D187E probably damaging Het
Cacna1b T A 2: 24,685,796 M747L probably benign Het
Cacna2d4 C A 6: 119,300,352 D675E probably damaging Het
Calcr G A 6: 3,687,615 T461M probably benign Het
Catip A G 1: 74,364,356 K126E probably damaging Het
Chga T C 12: 102,562,069 I273T probably benign Het
Clasp2 G A 9: 113,847,755 V185I probably benign Het
Cracr2a A G 6: 127,639,172 N370S probably benign Het
Crygc A T 1: 65,071,822 V102D probably benign Het
Ddx23 A G 15: 98,658,264 S58P unknown Het
Dlgap5 C T 14: 47,407,841 G281D probably benign Het
Dnah5 A T 15: 28,387,953 Y3186F probably damaging Het
Dpp6 A C 5: 27,631,399 I296L probably benign Het
Elfn2 C T 15: 78,672,460 R629H probably damaging Het
Eml2 G T 7: 19,181,224 probably null Het
Fitm1 T A 14: 55,576,449 V134E probably damaging Het
Flnb A G 14: 7,907,243 N1272S probably benign Het
Fuca1 G A 4: 135,934,803 W347* probably null Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gls2 G A 10: 128,199,256 R86H probably damaging Het
Grin2b T C 6: 135,733,488 K1020R probably benign Het
H2-DMb1 T A 17: 34,157,353 W149R probably damaging Het
Herc1 T A 9: 66,475,935 S3629R probably benign Het
Itih4 A T 14: 30,899,443 N821I possibly damaging Het
Kmt2d A T 15: 98,842,064 L4731Q unknown Het
Loxhd1 A T 18: 77,340,149 I472F possibly damaging Het
Lrp2 C A 2: 69,509,369 C1066F probably damaging Het
Mllt10 T A 2: 18,109,826 F114I probably damaging Het
Mpp5 A T 12: 78,820,851 Q336L probably benign Het
N4bp1 T C 8: 86,861,008 E434G probably benign Het
N6amt1 T C 16: 87,354,340 F30L probably damaging Het
Naca G A 10: 128,041,531 V811I unknown Het
Nobox A C 6: 43,305,167 I324S possibly damaging Het
Nup210l T C 3: 90,136,058 S442P probably benign Het
Olfr791 A T 10: 129,526,940 T238S probably damaging Het
Osbpl1a A T 18: 12,905,042 L284Q probably damaging Het
Pcdhb20 A C 18: 37,506,173 Y584S possibly damaging Het
Pgpep1l A T 7: 68,237,771 F27Y probably benign Het
Pik3cg T G 12: 32,195,688 I854L probably benign Het
Pot1a C T 6: 25,771,536 V229M possibly damaging Het
Prh1 C T 6: 132,571,859 P110S unknown Het
Prkag3 C T 1: 74,747,207 C193Y probably damaging Het
Prl2c5 T C 13: 13,185,954 F69L probably benign Het
Ptprq T C 10: 107,608,433 T1437A probably benign Het
Rabgap1 T C 2: 37,537,305 Y633H probably damaging Het
Rad54l2 G A 9: 106,713,502 T475I possibly damaging Het
Retreg1 C A 15: 25,969,799 A130E probably benign Het
Rps6kb1 G T 11: 86,535,436 H56N probably benign Het
Sars2 A G 7: 28,750,285 H385R probably damaging Het
Sbpl T G 17: 23,953,270 N225T unknown Het
Scml4 T C 10: 42,930,606 probably null Het
Scrib G A 15: 76,066,091 T302M probably benign Het
Sdk2 G A 11: 113,827,089 T1483I possibly damaging Het
Sh3bgrl3 A G 4: 134,128,079 S19P probably damaging Het
Slc10a6 C T 5: 103,612,461 V223I probably benign Het
Slc4a3 A G 1: 75,555,945 T950A probably benign Het
Spats2 A T 15: 99,167,080 D9V possibly damaging Het
Sphk1 A T 11: 116,535,078 probably null Het
Tex10 A T 4: 48,431,066 S897R probably benign Het
Tmco3 T C 8: 13,303,873 V395A probably damaging Het
Ubac2 T C 14: 121,983,305 M184T probably benign Het
Wdr95 T C 5: 149,588,133 S433P probably damaging Het
Zfp202 T A 9: 40,211,242 H433Q probably benign Het
Zfp526 G T 7: 25,225,312 R332L probably damaging Het
Other mutations in Ttc7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Ttc7b APN 12 100376213 missense probably benign 0.03
IGL01377:Ttc7b APN 12 100355112 missense probably benign 0.21
IGL01617:Ttc7b APN 12 100385956 missense possibly damaging 0.94
IGL02928:Ttc7b APN 12 100403415 missense probably damaging 1.00
IGL03183:Ttc7b APN 12 100373709 splice site probably null
IGL03341:Ttc7b APN 12 100325735 missense possibly damaging 0.66
R0302:Ttc7b UTSW 12 100387179 missense possibly damaging 0.94
R0620:Ttc7b UTSW 12 100500073 splice site probably null
R0625:Ttc7b UTSW 12 100355046 missense probably benign 0.04
R1016:Ttc7b UTSW 12 100403358 missense probably null 1.00
R1131:Ttc7b UTSW 12 100382119 critical splice donor site probably null
R1241:Ttc7b UTSW 12 100403439 missense possibly damaging 0.90
R1710:Ttc7b UTSW 12 100403408 missense probably damaging 0.98
R1803:Ttc7b UTSW 12 100407002 missense possibly damaging 0.94
R1887:Ttc7b UTSW 12 100415130 splice site probably null
R1920:Ttc7b UTSW 12 100415130 splice site probably null
R1921:Ttc7b UTSW 12 100415130 splice site probably null
R1922:Ttc7b UTSW 12 100415130 splice site probably null
R2062:Ttc7b UTSW 12 100325689 missense probably damaging 1.00
R2239:Ttc7b UTSW 12 100355001 critical splice donor site probably null
R2380:Ttc7b UTSW 12 100355001 critical splice donor site probably null
R4581:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4582:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4598:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4599:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4600:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4601:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4779:Ttc7b UTSW 12 100403362 missense probably damaging 1.00
R5027:Ttc7b UTSW 12 100301742 missense probably damaging 1.00
R5244:Ttc7b UTSW 12 100348010 missense probably damaging 0.99
R5387:Ttc7b UTSW 12 100446963 missense possibly damaging 0.64
R5739:Ttc7b UTSW 12 100384233 missense probably damaging 1.00
R5997:Ttc7b UTSW 12 100373560 missense probably damaging 0.96
R6223:Ttc7b UTSW 12 100387109 critical splice donor site probably null
R6238:Ttc7b UTSW 12 100495422 missense probably benign 0.31
R6318:Ttc7b UTSW 12 100325677 missense probably damaging 0.99
R6494:Ttc7b UTSW 12 100495407 missense possibly damaging 0.73
R7153:Ttc7b UTSW 12 100355034 missense probably damaging 1.00
R8132:Ttc7b UTSW 12 100446872 missense probably damaging 0.99
R8364:Ttc7b UTSW 12 100325558 missense probably benign 0.40
R8536:Ttc7b UTSW 12 100373544 missense possibly damaging 0.56
R8719:Ttc7b UTSW 12 100301553 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATCGATTCCCAGCACCTG -3'
(R):5'- GGGTTATTTCCAAAGCAAACCAG -3'

Sequencing Primer
(F):5'- ACCTGCTGGCTAGGAACCTG -3'
(R):5'- GAAACCCACTTTTAGCAGCAGGTG -3'
Posted On2020-06-30