Incidental Mutation 'R8085:Speg'
ID 629564
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene Name SPEG complex locus
Synonyms SPEG, SPEGalpha, SPEGbeta, Apeg1, BPEG, D1Bwg1450e
MMRRC Submission 067518-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8085 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 75351941-75408964 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75391997 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1593 (E1593G)
Ref Sequence ENSEMBL: ENSMUSP00000084361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087122]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000087122
AA Change: E1593G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: E1593G

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137868
AA Change: E1340G

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.0%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 G T 9: 30,854,611 (GRCm39) R160L probably benign Het
Atp11b T C 3: 35,895,185 (GRCm39) S908P probably benign Het
AW146154 C T 7: 41,130,621 (GRCm39) G165D possibly damaging Het
AW146154 C A 7: 41,130,622 (GRCm39) G165C probably damaging Het
Cachd1 G A 4: 100,845,361 (GRCm39) G951D probably damaging Het
Clstn3 T C 6: 124,435,683 (GRCm39) N250D probably benign Het
Coch G C 12: 51,650,031 (GRCm39) G340A possibly damaging Het
Col18a1 A G 10: 76,924,741 (GRCm39) V226A unknown Het
Crocc2 G A 1: 93,130,578 (GRCm39) R953Q possibly damaging Het
Dgkh A T 14: 78,824,558 (GRCm39) probably null Het
Disp2 C T 2: 118,617,452 (GRCm39) L149F possibly damaging Het
Dpt T C 1: 164,650,756 (GRCm39) F186S probably damaging Het
Eif3l T G 15: 78,961,066 (GRCm39) Y40D probably damaging Het
Epha3 A C 16: 63,403,873 (GRCm39) Y743D probably damaging Het
Ercc6l2 A T 13: 63,992,367 (GRCm39) Y272F probably benign Het
Exoc2 G A 13: 31,124,686 (GRCm39) L9F probably damaging Het
Fkbp9 A G 6: 56,833,289 (GRCm39) T259A probably benign Het
Gm5622 A T 14: 51,895,201 (GRCm39) K120M probably damaging Het
Hectd1 A T 12: 51,795,679 (GRCm39) F2250Y probably damaging Het
Herc2 A G 7: 55,879,427 (GRCm39) I4682V probably benign Het
Hnf1a T C 5: 115,108,732 (GRCm39) T58A probably benign Het
Kctd1 T A 18: 15,140,901 (GRCm39) I610F possibly damaging Het
Kif5a A T 10: 127,075,178 (GRCm39) D478E probably benign Het
Klf13 G T 7: 63,541,497 (GRCm39) A210E probably damaging Het
Klhl20 C A 1: 160,921,354 (GRCm39) G543C probably damaging Het
Krt78 T C 15: 101,855,715 (GRCm39) T699A possibly damaging Het
Lgr5 A T 10: 115,311,102 (GRCm39) D231E probably benign Het
Lonrf1 C A 8: 36,715,769 (GRCm39) G289W probably damaging Het
Lyst T C 13: 13,808,894 (GRCm39) L188P probably damaging Het
Mab21l2 T C 3: 86,455,393 (GRCm39) probably benign Het
Macf1 A G 4: 123,303,875 (GRCm39) V209A possibly damaging Het
Mctp1 A C 13: 76,972,972 (GRCm39) R658S probably benign Het
Mdfi T C 17: 48,127,042 (GRCm39) T178A probably damaging Het
Msln T A 17: 25,971,942 (GRCm39) K92* probably null Het
Msx3 T C 7: 139,627,998 (GRCm39) H113R unknown Het
Muc6 T A 7: 141,226,729 (GRCm39) T1433S unknown Het
Musk T A 4: 58,373,110 (GRCm39) S693R probably benign Het
Myh13 A G 11: 67,225,613 (GRCm39) K296R probably benign Het
Mylip A T 13: 45,563,928 (GRCm39) H427L possibly damaging Het
Nradd G T 9: 110,451,179 (GRCm39) T63K possibly damaging Het
Ntaq1 T G 15: 58,015,983 (GRCm39) probably null Het
Or5h17 A G 16: 58,820,432 (GRCm39) N128S probably benign Het
Or5p66 G T 7: 107,885,620 (GRCm39) Q238K probably benign Het
Osbp2 A G 11: 3,662,521 (GRCm39) L187P probably damaging Het
Oxct1 A G 15: 4,158,350 (GRCm39) D428G probably damaging Het
Oxsm G T 14: 16,242,439 (GRCm38) S110* probably null Het
Pard6a A G 8: 106,429,642 (GRCm39) Q230R probably damaging Het
Pkhd1 C A 1: 20,683,639 (GRCm39) W38L probably damaging Het
Plekhh2 A G 17: 84,905,384 (GRCm39) N1093D probably damaging Het
Rttn C T 18: 89,071,672 (GRCm39) Q1240* probably null Het
Serpina1d T C 12: 103,730,087 (GRCm39) E365G probably damaging Het
Sis A T 3: 72,814,462 (GRCm39) H1589Q probably damaging Het
Slc40a1 A T 1: 45,957,528 (GRCm39) I152N probably damaging Het
Slc44a5 C T 3: 153,928,414 (GRCm39) P59S probably damaging Het
Smarca4 T A 9: 21,570,108 (GRCm39) probably null Het
Smim33 A T 18: 35,861,573 (GRCm39) D19V probably benign Het
Spag9 A G 11: 93,989,870 (GRCm39) Y930C probably benign Het
St3gal5 G T 6: 72,074,925 (GRCm39) A62S unknown Het
Stx1a T C 5: 135,066,431 (GRCm39) probably null Het
Syne1 T A 10: 5,178,021 (GRCm39) I4818F possibly damaging Het
Tango6 A G 8: 107,447,366 (GRCm39) H588R probably benign Het
Tapt1 T C 5: 44,336,307 (GRCm39) Y454C probably damaging Het
Tep1 A G 14: 51,066,753 (GRCm39) Y2282H probably benign Het
Tle6 A T 10: 81,431,792 (GRCm39) W151R probably damaging Het
Tmem131l A T 3: 83,834,438 (GRCm39) M715K possibly damaging Het
Ubr1 T A 2: 120,764,898 (GRCm39) R519* probably null Het
Usp1 A T 4: 98,816,578 (GRCm39) N93I probably damaging Het
Vmn1r211 A T 13: 23,035,953 (GRCm39) M238K probably damaging Het
Vmn1r238 A G 18: 3,123,151 (GRCm39) Y88H probably damaging Het
Vmn2r62 A G 7: 42,437,270 (GRCm39) Y405H probably damaging Het
Vmn2r78 A G 7: 86,603,998 (GRCm39) I725M probably benign Het
Zfp12 C T 5: 143,230,681 (GRCm39) T368M probably damaging Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75,387,034 (GRCm39) missense possibly damaging 0.95
IGL00979:Speg APN 1 75,387,378 (GRCm39) missense probably damaging 0.98
IGL01122:Speg APN 1 75,386,679 (GRCm39) missense probably damaging 1.00
IGL01293:Speg APN 1 75,364,746 (GRCm39) missense probably damaging 1.00
IGL01304:Speg APN 1 75,404,841 (GRCm39) missense probably benign 0.00
IGL01351:Speg APN 1 75,387,920 (GRCm39) splice site probably benign
IGL01473:Speg APN 1 75,404,929 (GRCm39) missense possibly damaging 0.53
IGL01477:Speg APN 1 75,368,541 (GRCm39) missense probably damaging 1.00
IGL01485:Speg APN 1 75,364,471 (GRCm39) missense probably damaging 1.00
IGL01584:Speg APN 1 75,407,581 (GRCm39) missense probably damaging 1.00
IGL01959:Speg APN 1 75,367,734 (GRCm39) missense probably damaging 1.00
IGL02231:Speg APN 1 75,400,031 (GRCm39) missense probably damaging 1.00
IGL02355:Speg APN 1 75,400,559 (GRCm39) missense possibly damaging 0.49
IGL02362:Speg APN 1 75,400,559 (GRCm39) missense possibly damaging 0.49
IGL03013:Speg APN 1 75,407,923 (GRCm39) missense probably damaging 0.97
IGL03168:Speg APN 1 75,364,831 (GRCm39) missense probably damaging 1.00
H8562:Speg UTSW 1 75,392,241 (GRCm39) missense probably benign 0.39
R0112:Speg UTSW 1 75,361,676 (GRCm39) missense possibly damaging 0.92
R0311:Speg UTSW 1 75,407,581 (GRCm39) missense probably damaging 1.00
R0315:Speg UTSW 1 75,391,780 (GRCm39) missense possibly damaging 0.88
R0393:Speg UTSW 1 75,400,568 (GRCm39) missense possibly damaging 0.46
R0403:Speg UTSW 1 75,407,428 (GRCm39) splice site probably benign
R0483:Speg UTSW 1 75,361,676 (GRCm39) missense possibly damaging 0.92
R0648:Speg UTSW 1 75,404,622 (GRCm39) missense probably benign
R0683:Speg UTSW 1 75,405,762 (GRCm39) missense probably damaging 1.00
R0800:Speg UTSW 1 75,400,133 (GRCm39) missense probably damaging 1.00
R0815:Speg UTSW 1 75,392,036 (GRCm39) missense probably damaging 1.00
R0835:Speg UTSW 1 75,352,318 (GRCm39) missense probably benign 0.00
R0866:Speg UTSW 1 75,393,727 (GRCm39) missense probably damaging 0.99
R0880:Speg UTSW 1 75,381,705 (GRCm39) missense probably damaging 1.00
R1082:Speg UTSW 1 75,391,782 (GRCm39) missense possibly damaging 0.94
R1140:Speg UTSW 1 75,405,739 (GRCm39) missense probably damaging 1.00
R1252:Speg UTSW 1 75,403,739 (GRCm39) missense probably damaging 1.00
R1301:Speg UTSW 1 75,378,145 (GRCm39) missense probably damaging 1.00
R1348:Speg UTSW 1 75,399,516 (GRCm39) missense probably damaging 0.99
R1388:Speg UTSW 1 75,407,104 (GRCm39) missense probably damaging 0.99
R1465:Speg UTSW 1 75,405,128 (GRCm39) splice site probably benign
R1505:Speg UTSW 1 75,352,186 (GRCm39) missense probably benign 0.02
R1506:Speg UTSW 1 75,394,307 (GRCm39) missense probably benign 0.03
R1531:Speg UTSW 1 75,377,866 (GRCm39) missense possibly damaging 0.86
R1543:Speg UTSW 1 75,398,595 (GRCm39) missense probably damaging 1.00
R1567:Speg UTSW 1 75,404,691 (GRCm39) missense probably benign
R1630:Speg UTSW 1 75,399,621 (GRCm39) missense probably damaging 1.00
R1667:Speg UTSW 1 75,387,193 (GRCm39) splice site probably benign
R1673:Speg UTSW 1 75,387,807 (GRCm39) missense possibly damaging 0.60
R1718:Speg UTSW 1 75,398,388 (GRCm39) missense possibly damaging 0.87
R1718:Speg UTSW 1 75,394,507 (GRCm39) missense probably benign 0.00
R1719:Speg UTSW 1 75,394,507 (GRCm39) missense probably benign 0.00
R1759:Speg UTSW 1 75,377,806 (GRCm39) missense possibly damaging 0.95
R1861:Speg UTSW 1 75,365,649 (GRCm39) missense probably damaging 1.00
R1874:Speg UTSW 1 75,400,550 (GRCm39) missense probably benign
R1936:Speg UTSW 1 75,408,052 (GRCm39) missense possibly damaging 0.93
R2192:Speg UTSW 1 75,394,371 (GRCm39) missense probably damaging 1.00
R2204:Speg UTSW 1 75,407,121 (GRCm39) missense probably benign 0.30
R2287:Speg UTSW 1 75,407,109 (GRCm39) missense possibly damaging 0.76
R2696:Speg UTSW 1 75,383,570 (GRCm39) missense probably benign 0.27
R2983:Speg UTSW 1 75,361,574 (GRCm39) missense possibly damaging 0.83
R3110:Speg UTSW 1 75,399,326 (GRCm39) nonsense probably null
R3112:Speg UTSW 1 75,399,326 (GRCm39) nonsense probably null
R3154:Speg UTSW 1 75,378,186 (GRCm39) missense probably damaging 1.00
R3720:Speg UTSW 1 75,403,426 (GRCm39) missense probably damaging 1.00
R3983:Speg UTSW 1 75,399,191 (GRCm39) missense probably benign 0.27
R4133:Speg UTSW 1 75,404,548 (GRCm39) missense probably benign
R4522:Speg UTSW 1 75,404,974 (GRCm39) missense probably damaging 1.00
R4564:Speg UTSW 1 75,368,478 (GRCm39) missense probably damaging 1.00
R4577:Speg UTSW 1 75,392,039 (GRCm39) missense probably damaging 1.00
R4858:Speg UTSW 1 75,398,379 (GRCm39) missense probably damaging 1.00
R4953:Speg UTSW 1 75,400,508 (GRCm39) missense possibly damaging 0.72
R4965:Speg UTSW 1 75,404,347 (GRCm39) missense probably damaging 1.00
R4967:Speg UTSW 1 75,364,513 (GRCm39) missense probably damaging 1.00
R5152:Speg UTSW 1 75,404,742 (GRCm39) missense possibly damaging 0.92
R5156:Speg UTSW 1 75,404,731 (GRCm39) missense probably damaging 0.99
R5371:Speg UTSW 1 75,408,037 (GRCm39) missense possibly damaging 0.50
R5550:Speg UTSW 1 75,405,744 (GRCm39) missense probably damaging 1.00
R5562:Speg UTSW 1 75,403,700 (GRCm39) missense probably damaging 1.00
R5687:Speg UTSW 1 75,395,773 (GRCm39) splice site probably null
R5985:Speg UTSW 1 75,383,328 (GRCm39) missense possibly damaging 0.94
R6004:Speg UTSW 1 75,392,247 (GRCm39) nonsense probably null
R6038:Speg UTSW 1 75,395,103 (GRCm39) critical splice donor site probably null
R6038:Speg UTSW 1 75,395,103 (GRCm39) critical splice donor site probably null
R6143:Speg UTSW 1 75,391,031 (GRCm39) missense probably damaging 1.00
R6265:Speg UTSW 1 75,383,323 (GRCm39) nonsense probably null
R6347:Speg UTSW 1 75,403,519 (GRCm39) missense probably benign 0.00
R6453:Speg UTSW 1 75,394,616 (GRCm39) missense probably benign 0.06
R6505:Speg UTSW 1 75,406,167 (GRCm39) missense possibly damaging 0.93
R6505:Speg UTSW 1 75,383,328 (GRCm39) missense possibly damaging 0.94
R6531:Speg UTSW 1 75,399,401 (GRCm39) missense probably benign 0.03
R6566:Speg UTSW 1 75,365,107 (GRCm39) missense probably damaging 1.00
R6747:Speg UTSW 1 75,387,039 (GRCm39) critical splice donor site probably null
R6819:Speg UTSW 1 75,368,456 (GRCm39) missense possibly damaging 0.56
R6821:Speg UTSW 1 75,394,547 (GRCm39) missense possibly damaging 0.83
R6919:Speg UTSW 1 75,364,552 (GRCm39) nonsense probably null
R6981:Speg UTSW 1 75,407,557 (GRCm39) missense probably damaging 1.00
R7002:Speg UTSW 1 75,399,912 (GRCm39) missense probably damaging 0.98
R7082:Speg UTSW 1 75,388,091 (GRCm39) missense probably damaging 0.96
R7140:Speg UTSW 1 75,383,414 (GRCm39) critical splice donor site probably null
R7175:Speg UTSW 1 75,399,134 (GRCm39) missense probably benign 0.01
R7178:Speg UTSW 1 75,399,027 (GRCm39) missense possibly damaging 0.46
R7345:Speg UTSW 1 75,361,479 (GRCm39) missense probably damaging 0.97
R7420:Speg UTSW 1 75,407,549 (GRCm39) missense probably damaging 1.00
R7537:Speg UTSW 1 75,378,108 (GRCm39) missense probably damaging 1.00
R7562:Speg UTSW 1 75,407,923 (GRCm39) missense probably damaging 0.97
R7615:Speg UTSW 1 75,405,886 (GRCm39) missense probably damaging 1.00
R7679:Speg UTSW 1 75,382,959 (GRCm39) missense probably damaging 1.00
R7692:Speg UTSW 1 75,377,834 (GRCm39) missense probably benign 0.04
R7696:Speg UTSW 1 75,405,805 (GRCm39) missense probably damaging 1.00
R7719:Speg UTSW 1 75,352,469 (GRCm39) missense probably damaging 1.00
R7794:Speg UTSW 1 75,365,514 (GRCm39) missense probably benign 0.00
R7824:Speg UTSW 1 75,360,661 (GRCm39) splice site probably null
R7834:Speg UTSW 1 75,361,571 (GRCm39) missense probably damaging 1.00
R7892:Speg UTSW 1 75,403,810 (GRCm39) missense probably damaging 1.00
R8015:Speg UTSW 1 75,392,065 (GRCm39) splice site probably benign
R8068:Speg UTSW 1 75,398,894 (GRCm39) missense probably damaging 1.00
R8130:Speg UTSW 1 75,392,240 (GRCm39) missense probably damaging 1.00
R8132:Speg UTSW 1 75,399,639 (GRCm39) missense probably damaging 1.00
R8239:Speg UTSW 1 75,395,677 (GRCm39) missense probably damaging 1.00
R8287:Speg UTSW 1 75,398,880 (GRCm39) missense probably benign 0.26
R8299:Speg UTSW 1 75,364,480 (GRCm39) missense possibly damaging 0.95
R8441:Speg UTSW 1 75,387,976 (GRCm39) missense possibly damaging 0.60
R8468:Speg UTSW 1 75,407,953 (GRCm39) missense probably damaging 1.00
R8555:Speg UTSW 1 75,378,908 (GRCm39) splice site probably null
R8781:Speg UTSW 1 75,383,665 (GRCm39) missense probably damaging 1.00
R8784:Speg UTSW 1 75,381,793 (GRCm39) critical splice donor site probably benign
R8848:Speg UTSW 1 75,404,082 (GRCm39) critical splice donor site probably null
R8881:Speg UTSW 1 75,377,795 (GRCm39) missense possibly damaging 0.67
R8898:Speg UTSW 1 75,365,517 (GRCm39) missense probably damaging 1.00
R8935:Speg UTSW 1 75,399,250 (GRCm39) missense probably benign 0.30
R9019:Speg UTSW 1 75,405,882 (GRCm39) missense probably damaging 1.00
R9027:Speg UTSW 1 75,365,076 (GRCm39) missense possibly damaging 0.67
R9066:Speg UTSW 1 75,361,654 (GRCm39) missense probably damaging 0.99
R9092:Speg UTSW 1 75,399,378 (GRCm39) missense probably benign 0.01
R9117:Speg UTSW 1 75,364,444 (GRCm39) missense probably damaging 1.00
R9202:Speg UTSW 1 75,367,637 (GRCm39) missense probably damaging 1.00
R9246:Speg UTSW 1 75,361,498 (GRCm39) missense probably damaging 1.00
R9248:Speg UTSW 1 75,398,420 (GRCm39) missense probably damaging 1.00
R9451:Speg UTSW 1 75,394,377 (GRCm39) missense probably damaging 1.00
R9452:Speg UTSW 1 75,399,152 (GRCm39) missense probably benign
R9475:Speg UTSW 1 75,364,735 (GRCm39) missense probably damaging 1.00
R9476:Speg UTSW 1 75,377,768 (GRCm39) missense probably damaging 0.99
R9510:Speg UTSW 1 75,377,768 (GRCm39) missense probably damaging 0.99
R9519:Speg UTSW 1 75,392,380 (GRCm39) missense probably damaging 1.00
R9528:Speg UTSW 1 75,364,447 (GRCm39) missense possibly damaging 0.78
R9542:Speg UTSW 1 75,399,426 (GRCm39) missense probably benign 0.08
R9553:Speg UTSW 1 75,394,645 (GRCm39) missense probably benign 0.00
R9767:Speg UTSW 1 75,403,825 (GRCm39) missense possibly damaging 0.78
R9768:Speg UTSW 1 75,395,617 (GRCm39) nonsense probably null
R9800:Speg UTSW 1 75,399,358 (GRCm39) missense probably benign 0.03
X0025:Speg UTSW 1 75,399,101 (GRCm39) missense probably damaging 1.00
X0026:Speg UTSW 1 75,400,119 (GRCm39) missense possibly damaging 0.88
Z1176:Speg UTSW 1 75,383,238 (GRCm39) missense probably damaging 1.00
Z1177:Speg UTSW 1 75,404,327 (GRCm39) missense probably damaging 1.00
Z1177:Speg UTSW 1 75,407,099 (GRCm39) missense probably damaging 0.99
Z1177:Speg UTSW 1 75,405,025 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCGTCTATACCTGTACCG -3'
(R):5'- AGGTGACAAGACACTGCTG -3'

Sequencing Primer
(F):5'- AGGCGAAGTCTCCTGCAAG -3'
(R):5'- CTGCTGTTACAACAACGCTG -3'
Posted On 2020-06-30