Incidental Mutation 'R8085:Clstn3'
ID629583
Institutional Source Beutler Lab
Gene Symbol Clstn3
Ensembl Gene ENSMUSG00000008153
Gene Namecalsyntenin 3
Synonymsalcadein-beta, Cst-3, CSTN3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8085 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location124430759-124464794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124458724 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 250 (N250D)
Ref Sequence ENSEMBL: ENSMUSP00000008297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008297] [ENSMUST00000112523] [ENSMUST00000150774]
Predicted Effect probably benign
Transcript: ENSMUST00000008297
AA Change: N250D

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000008297
Gene: ENSMUSG00000008153
AA Change: N250D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CA 50 143 2.72e-12 SMART
CA 166 244 4.04e-2 SMART
SCOP:d1a8d_1 333 549 7e-23 SMART
transmembrane domain 846 868 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112523
AA Change: N213D

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108142
Gene: ENSMUSG00000008153
AA Change: N213D

DomainStartEndE-ValueType
CA 13 106 2.72e-12 SMART
CA 129 207 4.04e-2 SMART
Pfam:Laminin_G_3 304 505 4.1e-8 PFAM
transmembrane domain 809 831 N/A INTRINSIC
low complexity region 891 908 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150774
SMART Domains Protein: ENSMUSP00000145422
Gene: ENSMUSG00000008153

DomainStartEndE-ValueType
Blast:CA 13 64 4e-31 BLAST
Meta Mutation Damage Score 0.0654 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.0%
Validation Efficiency 99% (81/82)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reductions in excitatory and inhibitory synapse density and deficits in synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066B19Rik A T 18: 35,728,520 D19V probably benign Het
Adamts8 G T 9: 30,943,315 R160L probably benign Het
Atp11b T C 3: 35,841,036 S908P probably benign Het
AW146154 C T 7: 41,481,197 G165D possibly damaging Het
AW146154 C A 7: 41,481,198 G165C probably damaging Het
Cachd1 G A 4: 100,988,164 G951D probably damaging Het
Coch G C 12: 51,603,248 G340A possibly damaging Het
Col18a1 A G 10: 77,088,907 V226A unknown Het
Crocc2 G A 1: 93,202,856 R953Q possibly damaging Het
Dgkh A T 14: 78,587,118 probably null Het
Disp2 C T 2: 118,786,971 L149F possibly damaging Het
Dpt T C 1: 164,823,187 F186S probably damaging Het
Eif3l T G 15: 79,076,866 Y40D probably damaging Het
Epha3 A C 16: 63,583,510 Y743D probably damaging Het
Ercc6l2 A T 13: 63,844,553 Y272F probably benign Het
Exoc2 G A 13: 30,940,703 L9F probably damaging Het
Fkbp9 A G 6: 56,856,304 T259A probably benign Het
Gm5622 A T 14: 51,657,744 K120M probably damaging Het
Hectd1 A T 12: 51,748,896 F2250Y probably damaging Het
Herc2 A G 7: 56,229,679 I4682V probably benign Het
Hnf1a T C 5: 114,970,673 T58A probably benign Het
Kctd1 T A 18: 15,007,844 I610F possibly damaging Het
Kif5a A T 10: 127,239,309 D478E probably benign Het
Klf13 G T 7: 63,891,749 A210E probably damaging Het
Klhl20 C A 1: 161,093,784 G543C probably damaging Het
Krt78 T C 15: 101,947,280 T699A possibly damaging Het
Lgr5 A T 10: 115,475,197 D231E probably benign Het
Lonrf1 C A 8: 36,248,615 G289W probably damaging Het
Lyst T C 13: 13,634,309 L188P probably damaging Het
Mab21l2 T C 3: 86,548,086 probably benign Het
Macf1 A G 4: 123,410,082 V209A possibly damaging Het
Mctp1 A C 13: 76,824,853 R658S probably benign Het
Mdfi T C 17: 47,816,117 T178A probably damaging Het
Msln T A 17: 25,752,968 K92* probably null Het
Msx3 T C 7: 140,048,085 H113R unknown Het
Muc6 T A 7: 141,640,462 T1433S unknown Het
Musk T A 4: 58,373,110 S693R probably benign Het
Myh13 A G 11: 67,334,787 K296R probably benign Het
Mylip A T 13: 45,410,452 H427L possibly damaging Het
Nradd G T 9: 110,622,111 T63K possibly damaging Het
Olfr183 A G 16: 59,000,069 N128S probably benign Het
Olfr490 G T 7: 108,286,413 Q238K probably benign Het
Osbp2 A G 11: 3,712,521 L187P probably damaging Het
Oxct1 A G 15: 4,128,868 D428G probably damaging Het
Oxsm G T 14: 16,242,439 S110* probably null Het
Pard6a A G 8: 105,703,010 Q230R probably damaging Het
Pkhd1 C A 1: 20,613,415 W38L probably damaging Het
Plekhh2 A G 17: 84,597,956 N1093D probably damaging Het
Rttn C T 18: 89,053,548 Q1240* probably null Het
Serpina1d T C 12: 103,763,828 E365G probably damaging Het
Sis A T 3: 72,907,129 H1589Q probably damaging Het
Slc40a1 A T 1: 45,918,368 I152N probably damaging Het
Slc44a5 C T 3: 154,222,777 P59S probably damaging Het
Smarca4 T A 9: 21,658,812 probably null Het
Spag9 A G 11: 94,099,044 Y930C probably benign Het
Speg A G 1: 75,415,353 E1593G probably damaging Het
St3gal5 G T 6: 72,097,941 A62S unknown Het
Stx1a T C 5: 135,037,577 probably null Het
Syne1 T A 10: 5,228,021 I4818F possibly damaging Het
Tango6 A G 8: 106,720,734 H588R probably benign Het
Tapt1 T C 5: 44,178,965 Y454C probably damaging Het
Tep1 A G 14: 50,829,296 Y2282H probably benign Het
Tle6 A T 10: 81,595,958 W151R probably damaging Het
Tmem131l A T 3: 83,927,131 M715K possibly damaging Het
Ubr1 T A 2: 120,934,417 R519* probably null Het
Usp1 A T 4: 98,928,341 N93I probably damaging Het
Vmn1r211 A T 13: 22,851,783 M238K probably damaging Het
Vmn1r238 A G 18: 3,123,151 Y88H probably damaging Het
Vmn2r62 A G 7: 42,787,846 Y405H probably damaging Het
Vmn2r78 A G 7: 86,954,790 I725M probably benign Het
Wdyhv1 T G 15: 58,152,587 probably null Het
Zfp12 C T 5: 143,244,926 T368M probably damaging Het
Other mutations in Clstn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Clstn3 APN 6 124462139 missense probably damaging 1.00
IGL01415:Clstn3 APN 6 124438822 nonsense probably null
IGL01521:Clstn3 APN 6 124458031 nonsense probably null
IGL01537:Clstn3 APN 6 124431600 missense possibly damaging 0.91
IGL01729:Clstn3 APN 6 124449794 missense probably benign 0.06
IGL01879:Clstn3 APN 6 124438810 missense probably damaging 1.00
IGL01998:Clstn3 APN 6 124458663 missense probably damaging 1.00
IGL03130:Clstn3 APN 6 124459263 missense probably damaging 0.98
IGL03405:Clstn3 APN 6 124438368 missense possibly damaging 0.95
PIT4403001:Clstn3 UTSW 6 124458023 missense probably damaging 1.00
R0049:Clstn3 UTSW 6 124459853 missense possibly damaging 0.87
R0049:Clstn3 UTSW 6 124459853 missense possibly damaging 0.87
R0208:Clstn3 UTSW 6 124432169 splice site probably benign
R0276:Clstn3 UTSW 6 124431740 splice site probably benign
R0440:Clstn3 UTSW 6 124451413 missense probably damaging 1.00
R0612:Clstn3 UTSW 6 124449500 missense probably damaging 0.98
R1200:Clstn3 UTSW 6 124459170 missense probably damaging 1.00
R1224:Clstn3 UTSW 6 124457919 missense probably benign
R1378:Clstn3 UTSW 6 124438419 missense probably damaging 1.00
R1491:Clstn3 UTSW 6 124437490 missense possibly damaging 0.51
R1495:Clstn3 UTSW 6 124449917 missense probably benign 0.00
R1511:Clstn3 UTSW 6 124462169 missense probably damaging 1.00
R1655:Clstn3 UTSW 6 124437427 missense probably damaging 1.00
R1731:Clstn3 UTSW 6 124431632 missense probably benign 0.04
R1734:Clstn3 UTSW 6 124436814 splice site probably benign
R1751:Clstn3 UTSW 6 124431999 missense probably damaging 1.00
R1954:Clstn3 UTSW 6 124459298 missense possibly damaging 0.94
R2133:Clstn3 UTSW 6 124449503 missense probably benign
R2192:Clstn3 UTSW 6 124459207 missense probably damaging 1.00
R2314:Clstn3 UTSW 6 124450717 missense probably benign 0.39
R2874:Clstn3 UTSW 6 124438335 missense probably damaging 1.00
R3500:Clstn3 UTSW 6 124431711 missense probably benign 0.01
R3761:Clstn3 UTSW 6 124457876 missense possibly damaging 0.54
R3878:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R3927:Clstn3 UTSW 6 124451368 missense probably damaging 1.00
R3934:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R3935:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R4063:Clstn3 UTSW 6 124449833 missense possibly damaging 0.51
R4402:Clstn3 UTSW 6 124456980 missense probably damaging 0.96
R4534:Clstn3 UTSW 6 124459220 missense probably damaging 1.00
R4785:Clstn3 UTSW 6 124437372 splice site probably null
R4834:Clstn3 UTSW 6 124431953 splice site probably null
R5921:Clstn3 UTSW 6 124431580 utr 3 prime probably benign
R5932:Clstn3 UTSW 6 124438332 missense probably benign 0.01
R6025:Clstn3 UTSW 6 124431664 missense possibly damaging 0.73
R6101:Clstn3 UTSW 6 124461670 missense probably damaging 1.00
R6360:Clstn3 UTSW 6 124438429 missense possibly damaging 0.88
R6578:Clstn3 UTSW 6 124450704 critical splice donor site probably null
R6813:Clstn3 UTSW 6 124436935 missense probably benign 0.00
R7380:Clstn3 UTSW 6 124456989 missense probably benign 0.01
R7419:Clstn3 UTSW 6 124458129 missense probably benign 0.05
R7625:Clstn3 UTSW 6 124437418 nonsense probably null
R7780:Clstn3 UTSW 6 124462202 missense probably damaging 0.98
R7936:Clstn3 UTSW 6 124432013 missense possibly damaging 0.73
R7939:Clstn3 UTSW 6 124462199 missense probably damaging 1.00
R8047:Clstn3 UTSW 6 124432013 missense possibly damaging 0.73
R8079:Clstn3 UTSW 6 124459804 missense probably damaging 1.00
R8299:Clstn3 UTSW 6 124437373 critical splice donor site probably null
R8406:Clstn3 UTSW 6 124462177 missense probably damaging 1.00
RF014:Clstn3 UTSW 6 124459266 nonsense probably null
X0066:Clstn3 UTSW 6 124449811 missense probably benign 0.13
Z1176:Clstn3 UTSW 6 124459200 missense probably damaging 1.00
Z1177:Clstn3 UTSW 6 124449781 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCAGGGGAGTCAAATTTC -3'
(R):5'- GCAGGTAAAACATCTGTCACATTG -3'

Sequencing Primer
(F):5'- CCACAGAGCTTCCGCAGAG -3'
(R):5'- GAGTACACTGTAGCTGTCTTCAGAC -3'
Posted On2020-06-30