Incidental Mutation 'R8085:Coch'
ID629606
Institutional Source Beutler Lab
Gene Symbol Coch
Ensembl Gene ENSMUSG00000020953
Gene Namecochlin
SynonymsCoch-5B2, D12H14S564E
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8085 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location51593341-51605771 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 51603248 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Alanine at position 340 (G340A)
Ref Sequence ENSEMBL: ENSMUSP00000082533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085412] [ENSMUST00000164782]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085412
AA Change: G340A

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000082533
Gene: ENSMUSG00000020953
AA Change: G340A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 32 114 3.64e-47 SMART
VWA 165 337 2.06e-33 SMART
VWA 367 540 6.43e-44 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000164782
AA Change: G340A

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128127
Gene: ENSMUSG00000020953
AA Change: G340A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 32 114 3.64e-47 SMART
VWA 165 337 2.06e-33 SMART
VWA 367 540 6.43e-44 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.0%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly conserved in human, mouse, and chicken, showing 94% and 79% amino acid identity of human to mouse and chicken sequences, respectively. Hybridization to this gene was detected in spindle-shaped cells located along nerve fibers between the auditory ganglion and sensory epithelium. These cells accompany neurites at the habenula perforata, the opening through which neurites extend to innervate hair cells. This and the pattern of expression of this gene in chicken inner ear paralleled the histologic findings of acidophilic deposits, consistent with mucopolysaccharide ground substance, in temporal bones from DFNA9 (autosomal dominant nonsyndromic sensorineural deafness 9) patients. Mutations that cause DFNA9 have been reported in this gene. Alternative splicing results in multiple transcript variants encoding the same protein. Additional splice variants encoding distinct isoforms have been described but their biological validities have not been demonstrated. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for a point mutation have vestibular and hearing dysfunctions that worsen with age. Homozyogtes for a null allele have no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066B19Rik A T 18: 35,728,520 D19V probably benign Het
Adamts8 G T 9: 30,943,315 R160L probably benign Het
Atp11b T C 3: 35,841,036 S908P probably benign Het
AW146154 C T 7: 41,481,197 G165D possibly damaging Het
AW146154 C A 7: 41,481,198 G165C probably damaging Het
Cachd1 G A 4: 100,988,164 G951D probably damaging Het
Clstn3 T C 6: 124,458,724 N250D probably benign Het
Col18a1 A G 10: 77,088,907 V226A unknown Het
Crocc2 G A 1: 93,202,856 R953Q possibly damaging Het
Dgkh A T 14: 78,587,118 probably null Het
Disp2 C T 2: 118,786,971 L149F possibly damaging Het
Dpt T C 1: 164,823,187 F186S probably damaging Het
Eif3l T G 15: 79,076,866 Y40D probably damaging Het
Epha3 A C 16: 63,583,510 Y743D probably damaging Het
Ercc6l2 A T 13: 63,844,553 Y272F probably benign Het
Exoc2 G A 13: 30,940,703 L9F probably damaging Het
Fkbp9 A G 6: 56,856,304 T259A probably benign Het
Gm5622 A T 14: 51,657,744 K120M probably damaging Het
Hectd1 A T 12: 51,748,896 F2250Y probably damaging Het
Herc2 A G 7: 56,229,679 I4682V probably benign Het
Hnf1a T C 5: 114,970,673 T58A probably benign Het
Kctd1 T A 18: 15,007,844 I610F possibly damaging Het
Kif5a A T 10: 127,239,309 D478E probably benign Het
Klf13 G T 7: 63,891,749 A210E probably damaging Het
Klhl20 C A 1: 161,093,784 G543C probably damaging Het
Krt78 T C 15: 101,947,280 T699A possibly damaging Het
Lgr5 A T 10: 115,475,197 D231E probably benign Het
Lonrf1 C A 8: 36,248,615 G289W probably damaging Het
Lyst T C 13: 13,634,309 L188P probably damaging Het
Mab21l2 T C 3: 86,548,086 probably benign Het
Macf1 A G 4: 123,410,082 V209A possibly damaging Het
Mctp1 A C 13: 76,824,853 R658S probably benign Het
Mdfi T C 17: 47,816,117 T178A probably damaging Het
Msln T A 17: 25,752,968 K92* probably null Het
Msx3 T C 7: 140,048,085 H113R unknown Het
Muc6 T A 7: 141,640,462 T1433S unknown Het
Musk T A 4: 58,373,110 S693R probably benign Het
Myh13 A G 11: 67,334,787 K296R probably benign Het
Mylip A T 13: 45,410,452 H427L possibly damaging Het
Nradd G T 9: 110,622,111 T63K possibly damaging Het
Olfr183 A G 16: 59,000,069 N128S probably benign Het
Olfr490 G T 7: 108,286,413 Q238K probably benign Het
Osbp2 A G 11: 3,712,521 L187P probably damaging Het
Oxct1 A G 15: 4,128,868 D428G probably damaging Het
Oxsm G T 14: 16,242,439 S110* probably null Het
Pard6a A G 8: 105,703,010 Q230R probably damaging Het
Pkhd1 C A 1: 20,613,415 W38L probably damaging Het
Plekhh2 A G 17: 84,597,956 N1093D probably damaging Het
Rttn C T 18: 89,053,548 Q1240* probably null Het
Serpina1d T C 12: 103,763,828 E365G probably damaging Het
Sis A T 3: 72,907,129 H1589Q probably damaging Het
Slc40a1 A T 1: 45,918,368 I152N probably damaging Het
Slc44a5 C T 3: 154,222,777 P59S probably damaging Het
Smarca4 T A 9: 21,658,812 probably null Het
Spag9 A G 11: 94,099,044 Y930C probably benign Het
Speg A G 1: 75,415,353 E1593G probably damaging Het
St3gal5 G T 6: 72,097,941 A62S unknown Het
Stx1a T C 5: 135,037,577 probably null Het
Syne1 T A 10: 5,228,021 I4818F possibly damaging Het
Tango6 A G 8: 106,720,734 H588R probably benign Het
Tapt1 T C 5: 44,178,965 Y454C probably damaging Het
Tep1 A G 14: 50,829,296 Y2282H probably benign Het
Tle6 A T 10: 81,595,958 W151R probably damaging Het
Tmem131l A T 3: 83,927,131 M715K possibly damaging Het
Ubr1 T A 2: 120,934,417 R519* probably null Het
Usp1 A T 4: 98,928,341 N93I probably damaging Het
Vmn1r211 A T 13: 22,851,783 M238K probably damaging Het
Vmn1r238 A G 18: 3,123,151 Y88H probably damaging Het
Vmn2r62 A G 7: 42,787,846 Y405H probably damaging Het
Vmn2r78 A G 7: 86,954,790 I725M probably benign Het
Wdyhv1 T G 15: 58,152,587 probably null Het
Zfp12 C T 5: 143,244,926 T368M probably damaging Het
Other mutations in Coch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Coch APN 12 51603353 missense probably damaging 1.00
IGL01803:Coch APN 12 51603299 missense probably benign 0.15
IGL02613:Coch APN 12 51595349 missense possibly damaging 0.76
IGL02697:Coch APN 12 51597038 missense probably benign 0.00
IGL03351:Coch APN 12 51603206 missense probably benign 0.05
R0732:Coch UTSW 12 51595372 missense probably damaging 1.00
R1485:Coch UTSW 12 51598289 missense probably damaging 1.00
R1757:Coch UTSW 12 51602848 missense probably damaging 1.00
R2073:Coch UTSW 12 51602689 missense probably benign 0.00
R2231:Coch UTSW 12 51602865 missense probably benign
R2440:Coch UTSW 12 51596562 missense probably damaging 0.99
R3104:Coch UTSW 12 51603421 missense probably benign
R3623:Coch UTSW 12 51602826 missense probably benign 0.06
R3624:Coch UTSW 12 51602826 missense probably benign 0.06
R3932:Coch UTSW 12 51603338 missense probably damaging 1.00
R3933:Coch UTSW 12 51603338 missense probably damaging 1.00
R3945:Coch UTSW 12 51601812 critical splice acceptor site probably null
R3946:Coch UTSW 12 51601812 critical splice acceptor site probably null
R4423:Coch UTSW 12 51598149 splice site probably null
R4660:Coch UTSW 12 51595485 missense probably benign 0.21
R4732:Coch UTSW 12 51605019 missense probably benign 0.28
R4733:Coch UTSW 12 51605019 missense probably benign 0.28
R4844:Coch UTSW 12 51602694 missense probably damaging 0.98
R4997:Coch UTSW 12 51603181 splice site probably null
R5152:Coch UTSW 12 51595442 missense probably benign 0.00
R5173:Coch UTSW 12 51596507 nonsense probably null
R6134:Coch UTSW 12 51602753 missense probably damaging 1.00
R6481:Coch UTSW 12 51598173 missense probably damaging 1.00
R6497:Coch UTSW 12 51602721 missense probably benign 0.06
R6714:Coch UTSW 12 51602737 missense probably damaging 1.00
R6896:Coch UTSW 12 51602869 missense possibly damaging 0.62
R7242:Coch UTSW 12 51593561 start gained probably benign
R7463:Coch UTSW 12 51593625 start codon destroyed probably null 0.02
R7595:Coch UTSW 12 51598233 missense probably damaging 1.00
R8047:Coch UTSW 12 51603713 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCTGGGAACACATGCATAAG -3'
(R):5'- GCTGGTCATAAGTGAACTGTACAGC -3'

Sequencing Primer
(F):5'- CACATGCATAAGGTTCTAGGTTC -3'
(R):5'- AGCAGCTATCTTGGCTCCAATG -3'
Posted On2020-06-30