Incidental Mutation 'R8085:Lyst'
ID629609
Institutional Source Beutler Lab
Gene Symbol Lyst
Ensembl Gene ENSMUSG00000019726
Gene Namelysosomal trafficking regulator
SynonymsD13Sfk13
Accession Numbers

Ncbi RefSeq: NM_010748.2; MGI:107448

Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R8085 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location13590397-13778803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13634309 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 188 (L188P)
Ref Sequence ENSEMBL: ENSMUSP00000106188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110559]
Predicted Effect probably damaging
Transcript: ENSMUST00000110559
AA Change: L188P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726
AA Change: L188P

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
low complexity region 2427 2445 N/A INTRINSIC
low complexity region 2534 2546 N/A INTRINSIC
Pfam:PH_BEACH 3006 3101 5.8e-25 PFAM
Beach 3118 3408 1.25e-193 SMART
Blast:Beach 3441 3478 9e-13 BLAST
WD40 3539 3579 5.75e-1 SMART
WD40 3591 3630 2.89e-5 SMART
WD40 3633 3676 1.38e0 SMART
WD40 3724 3765 1.27e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.0%
Validation Efficiency 99% (81/82)
MGI Phenotype Strain: 1855968
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Targeted(3) Gene trapped(34) Spontaneous(8) Chemically induced(6) Radiation induced(1)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066B19Rik A T 18: 35,728,520 D19V probably benign Het
Adamts8 G T 9: 30,943,315 R160L probably benign Het
Atp11b T C 3: 35,841,036 S908P probably benign Het
AW146154 C T 7: 41,481,197 G165D possibly damaging Het
AW146154 C A 7: 41,481,198 G165C probably damaging Het
Cachd1 G A 4: 100,988,164 G951D probably damaging Het
Clstn3 T C 6: 124,458,724 N250D probably benign Het
Coch G C 12: 51,603,248 G340A possibly damaging Het
Col18a1 A G 10: 77,088,907 V226A unknown Het
Crocc2 G A 1: 93,202,856 R953Q possibly damaging Het
Dgkh A T 14: 78,587,118 probably null Het
Disp2 C T 2: 118,786,971 L149F possibly damaging Het
Dpt T C 1: 164,823,187 F186S probably damaging Het
Eif3l T G 15: 79,076,866 Y40D probably damaging Het
Epha3 A C 16: 63,583,510 Y743D probably damaging Het
Ercc6l2 A T 13: 63,844,553 Y272F probably benign Het
Exoc2 G A 13: 30,940,703 L9F probably damaging Het
Fkbp9 A G 6: 56,856,304 T259A probably benign Het
Gm5622 A T 14: 51,657,744 K120M probably damaging Het
Hectd1 A T 12: 51,748,896 F2250Y probably damaging Het
Herc2 A G 7: 56,229,679 I4682V probably benign Het
Hnf1a T C 5: 114,970,673 T58A probably benign Het
Kctd1 T A 18: 15,007,844 I610F possibly damaging Het
Kif5a A T 10: 127,239,309 D478E probably benign Het
Klf13 G T 7: 63,891,749 A210E probably damaging Het
Klhl20 C A 1: 161,093,784 G543C probably damaging Het
Krt78 T C 15: 101,947,280 T699A possibly damaging Het
Lgr5 A T 10: 115,475,197 D231E probably benign Het
Lonrf1 C A 8: 36,248,615 G289W probably damaging Het
Mab21l2 T C 3: 86,548,086 probably benign Het
Macf1 A G 4: 123,410,082 V209A possibly damaging Het
Mctp1 A C 13: 76,824,853 R658S probably benign Het
Mdfi T C 17: 47,816,117 T178A probably damaging Het
Msln T A 17: 25,752,968 K92* probably null Het
Msx3 T C 7: 140,048,085 H113R unknown Het
Muc6 T A 7: 141,640,462 T1433S unknown Het
Musk T A 4: 58,373,110 S693R probably benign Het
Myh13 A G 11: 67,334,787 K296R probably benign Het
Mylip A T 13: 45,410,452 H427L possibly damaging Het
Nradd G T 9: 110,622,111 T63K possibly damaging Het
Olfr183 A G 16: 59,000,069 N128S probably benign Het
Olfr490 G T 7: 108,286,413 Q238K probably benign Het
Osbp2 A G 11: 3,712,521 L187P probably damaging Het
Oxct1 A G 15: 4,128,868 D428G probably damaging Het
Oxsm G T 14: 16,242,439 S110* probably null Het
Pard6a A G 8: 105,703,010 Q230R probably damaging Het
Pkhd1 C A 1: 20,613,415 W38L probably damaging Het
Plekhh2 A G 17: 84,597,956 N1093D probably damaging Het
Rttn C T 18: 89,053,548 Q1240* probably null Het
Serpina1d T C 12: 103,763,828 E365G probably damaging Het
Sis A T 3: 72,907,129 H1589Q probably damaging Het
Slc40a1 A T 1: 45,918,368 I152N probably damaging Het
Slc44a5 C T 3: 154,222,777 P59S probably damaging Het
Smarca4 T A 9: 21,658,812 probably null Het
Spag9 A G 11: 94,099,044 Y930C probably benign Het
Speg A G 1: 75,415,353 E1593G probably damaging Het
St3gal5 G T 6: 72,097,941 A62S unknown Het
Stx1a T C 5: 135,037,577 probably null Het
Syne1 T A 10: 5,228,021 I4818F possibly damaging Het
Tango6 A G 8: 106,720,734 H588R probably benign Het
Tapt1 T C 5: 44,178,965 Y454C probably damaging Het
Tep1 A G 14: 50,829,296 Y2282H probably benign Het
Tle6 A T 10: 81,595,958 W151R probably damaging Het
Tmem131l A T 3: 83,927,131 M715K possibly damaging Het
Ubr1 T A 2: 120,934,417 R519* probably null Het
Usp1 A T 4: 98,928,341 N93I probably damaging Het
Vmn1r211 A T 13: 22,851,783 M238K probably damaging Het
Vmn1r238 A G 18: 3,123,151 Y88H probably damaging Het
Vmn2r62 A G 7: 42,787,846 Y405H probably damaging Het
Vmn2r78 A G 7: 86,954,790 I725M probably benign Het
Wdyhv1 T G 15: 58,152,587 probably null Het
Zfp12 C T 5: 143,244,926 T368M probably damaging Het
Other mutations in Lyst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lyst APN 13 13648878 missense probably benign
IGL00474:Lyst APN 13 13643536 missense possibly damaging 0.48
IGL00484:Lyst APN 13 13709603 missense probably benign 0.02
IGL00492:Lyst APN 13 13678175 missense possibly damaging 0.54
IGL00807:Lyst APN 13 13650423 missense possibly damaging 0.91
IGL00949:Lyst APN 13 13635485 missense possibly damaging 0.87
IGL00952:Lyst APN 13 13678107 missense probably benign 0.05
IGL01305:Lyst APN 13 13678056 missense probably benign 0.01
IGL01317:Lyst APN 13 13670870 missense probably benign
IGL01419:Lyst APN 13 13635838 missense probably benign 0.00
IGL01445:Lyst APN 13 13651714 missense probably benign 0.00
IGL01690:Lyst APN 13 13743246 missense probably damaging 1.00
IGL01791:Lyst APN 13 13635302 missense probably damaging 1.00
IGL01809:Lyst APN 13 13637803 missense probably damaging 1.00
IGL01896:Lyst APN 13 13635577 missense probably benign 0.04
IGL01938:Lyst APN 13 13637424 missense possibly damaging 0.93
IGL01986:Lyst APN 13 13775627 critical splice donor site probably null
IGL02022:Lyst APN 13 13664044 nonsense probably null
IGL02044:Lyst APN 13 13712846 missense probably damaging 1.00
IGL02157:Lyst APN 13 13660956 missense probably benign
IGL02185:Lyst APN 13 13661093 nonsense probably null
IGL02215:Lyst APN 13 13660956 missense probably benign
IGL02245:Lyst APN 13 13660956 missense probably benign
IGL02246:Lyst APN 13 13660956 missense probably benign
IGL02247:Lyst APN 13 13660956 missense probably benign
IGL02297:Lyst APN 13 13638092 nonsense probably null
IGL02411:Lyst APN 13 13660956 missense probably benign
IGL02415:Lyst APN 13 13660956 missense probably benign
IGL02419:Lyst APN 13 13660956 missense probably benign
IGL02420:Lyst APN 13 13660956 missense probably benign
IGL02429:Lyst APN 13 13660956 missense probably benign
IGL02501:Lyst APN 13 13711645 missense probably benign 0.02
IGL02522:Lyst APN 13 13634705 missense possibly damaging 0.81
IGL02535:Lyst APN 13 13650342 missense probably benign 0.00
IGL02596:Lyst APN 13 13660956 missense probably benign
IGL02601:Lyst APN 13 13660956 missense probably benign
IGL02603:Lyst APN 13 13660956 missense probably benign
IGL02608:Lyst APN 13 13712754 missense probably damaging 0.98
IGL02622:Lyst APN 13 13681390 missense probably damaging 1.00
IGL02690:Lyst APN 13 13641125 missense possibly damaging 0.58
IGL02715:Lyst APN 13 13674320 splice site probably null
IGL02725:Lyst APN 13 13760827 missense probably damaging 1.00
IGL02729:Lyst APN 13 13674339 missense possibly damaging 0.81
IGL02729:Lyst APN 13 13746609 missense possibly damaging 0.95
IGL02820:Lyst APN 13 13638058 missense probably benign 0.03
IGL02945:Lyst APN 13 13761198 missense possibly damaging 0.48
IGL02981:Lyst APN 13 13634911 missense probably damaging 0.99
IGL03087:Lyst APN 13 13635056 missense probably damaging 1.00
IGL03149:Lyst APN 13 13681444 missense probably benign 0.14
IGL03158:Lyst APN 13 13651752 critical splice donor site probably null
IGL03226:Lyst APN 13 13709559 missense probably benign 0.01
IGL03242:Lyst APN 13 13656881 nonsense probably null
IGL03385:Lyst APN 13 13656980 nonsense probably null
50-cal UTSW 13 13708212 critical splice donor site probably null
charcoal UTSW 13 13696761 nonsense probably null
charlotte_gray UTSW 13 13602026 intron probably benign
charzard UTSW 13 13647083 nonsense probably null
grey_wolf UTSW 13 unclassified
lightspeed UTSW 13 13740536 missense possibly damaging 0.91
robin UTSW 13 13648802 nonsense probably null
sooty UTSW 13 unclassified
souris UTSW 13 13683224 unclassified probably benign
Swallow UTSW 13 13757422 missense probably benign 0.00
vulpix UTSW 13 13696794 splice site probably null
ANU22:Lyst UTSW 13 13678056 missense probably benign 0.01
IGL02835:Lyst UTSW 13 13661100 missense possibly damaging 0.82
P0031:Lyst UTSW 13 13664031 missense probably damaging 1.00
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0031:Lyst UTSW 13 13708156 missense probably benign 0.14
R0115:Lyst UTSW 13 13677952 missense probably benign 0.00
R0212:Lyst UTSW 13 13635985 missense possibly damaging 0.93
R0386:Lyst UTSW 13 13708214 splice site probably benign
R0393:Lyst UTSW 13 13647079 missense probably benign 0.01
R0415:Lyst UTSW 13 13711610 splice site probably benign
R0446:Lyst UTSW 13 13638048 missense probably benign 0.00
R0481:Lyst UTSW 13 13677952 missense probably benign 0.00
R0499:Lyst UTSW 13 13616713 missense probably damaging 1.00
R0506:Lyst UTSW 13 13638015 missense probably benign
R0530:Lyst UTSW 13 13757306 splice site probably benign
R0541:Lyst UTSW 13 13681293 missense probably benign 0.00
R0570:Lyst UTSW 13 13709386 missense probably benign 0.26
R0680:Lyst UTSW 13 13650341 missense probably benign 0.01
R0842:Lyst UTSW 13 13678241 nonsense probably null
R0848:Lyst UTSW 13 13634930 missense probably benign 0.00
R1014:Lyst UTSW 13 13634060 missense possibly damaging 0.49
R1205:Lyst UTSW 13 13680202 missense probably benign
R1251:Lyst UTSW 13 13634483 missense probably benign 0.00
R1304:Lyst UTSW 13 13751984 nonsense probably null
R1398:Lyst UTSW 13 13740536 missense possibly damaging 0.91
R1445:Lyst UTSW 13 13640054 missense possibly damaging 0.94
R1475:Lyst UTSW 13 13708212 critical splice donor site probably null
R1479:Lyst UTSW 13 13634482 missense probably benign 0.00
R1484:Lyst UTSW 13 13678190 missense probably benign 0.01
R1498:Lyst UTSW 13 13650375 missense possibly damaging 0.49
R1540:Lyst UTSW 13 13635101 missense possibly damaging 0.81
R1611:Lyst UTSW 13 13634897 missense probably damaging 0.97
R1653:Lyst UTSW 13 13635226 missense probably damaging 1.00
R1669:Lyst UTSW 13 13644087 missense possibly damaging 0.90
R1686:Lyst UTSW 13 13634705 missense possibly damaging 0.81
R1694:Lyst UTSW 13 13661161 missense probably damaging 0.98
R1747:Lyst UTSW 13 13757422 missense probably benign 0.00
R1793:Lyst UTSW 13 13647083 nonsense probably null
R1871:Lyst UTSW 13 13651712 missense probably benign 0.00
R1905:Lyst UTSW 13 13634134 missense probably benign
R1958:Lyst UTSW 13 13616618 missense probably damaging 1.00
R1969:Lyst UTSW 13 13730344 missense probably damaging 0.99
R2040:Lyst UTSW 13 13641222 missense probably benign 0.00
R2109:Lyst UTSW 13 13712820 missense possibly damaging 0.46
R2116:Lyst UTSW 13 13635701 missense probably damaging 0.99
R2121:Lyst UTSW 13 13660971 missense probably damaging 1.00
R2127:Lyst UTSW 13 13635262 missense probably damaging 1.00
R2187:Lyst UTSW 13 13709341 missense possibly damaging 0.61
R2238:Lyst UTSW 13 13743263 missense probably benign 0.41
R2258:Lyst UTSW 13 13637658 missense probably benign 0.00
R2292:Lyst UTSW 13 13740495 missense probably damaging 1.00
R2368:Lyst UTSW 13 13696663 missense probably damaging 0.96
R2908:Lyst UTSW 13 13669873 missense probably benign 0.03
R3001:Lyst UTSW 13 13696705 missense probably benign
R3002:Lyst UTSW 13 13696705 missense probably benign
R3024:Lyst UTSW 13 13658687 missense probably benign
R3113:Lyst UTSW 13 13669927 missense probably benign 0.12
R3406:Lyst UTSW 13 13635230 missense possibly damaging 0.56
R3972:Lyst UTSW 13 13706625 missense possibly damaging 0.67
R3978:Lyst UTSW 13 13634168 missense possibly damaging 0.82
R4032:Lyst UTSW 13 13616665 missense probably damaging 1.00
R4192:Lyst UTSW 13 13740513 missense probably damaging 1.00
R4206:Lyst UTSW 13 13635989 missense probably benign 0.03
R4298:Lyst UTSW 13 13634887 missense probably damaging 1.00
R4344:Lyst UTSW 13 13698466 missense probably benign 0.06
R4441:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4445:Lyst UTSW 13 13709564 missense probably benign 0.42
R4477:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4493:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4494:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4495:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4622:Lyst UTSW 13 13674398 missense probably benign 0.01
R4638:Lyst UTSW 13 13696794 splice site probably null
R4658:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4675:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4719:Lyst UTSW 13 13650350 missense probably benign
R4729:Lyst UTSW 13 13637901 missense probably damaging 1.00
R4774:Lyst UTSW 13 13740597 missense probably damaging 1.00
R4811:Lyst UTSW 13 13777100 missense probably benign 0.33
R4877:Lyst UTSW 13 13683149 missense probably damaging 1.00
R4920:Lyst UTSW 13 13647060 missense possibly damaging 0.79
R4933:Lyst UTSW 13 13637764 missense probably damaging 0.98
R4933:Lyst UTSW 13 13759378 missense probably benign 0.12
R4958:Lyst UTSW 13 13635463 missense probably benign 0.00
R4982:Lyst UTSW 13 13725954 missense probably damaging 1.00
R4992:Lyst UTSW 13 13661163 missense probably damaging 1.00
R5024:Lyst UTSW 13 13634404 missense probably benign
R5049:Lyst UTSW 13 13636064 missense probably damaging 1.00
R5079:Lyst UTSW 13 13757353 missense probably benign 0.08
R5254:Lyst UTSW 13 13683070 missense probably benign 0.00
R5266:Lyst UTSW 13 13660970 missense probably damaging 1.00
R5279:Lyst UTSW 13 13648802 nonsense probably null
R5285:Lyst UTSW 13 13634426 missense probably benign 0.01
R5364:Lyst UTSW 13 13656854 missense probably benign 0.35
R5435:Lyst UTSW 13 13777064 missense possibly damaging 0.64
R5516:Lyst UTSW 13 13644122 missense probably benign 0.10
R5524:Lyst UTSW 13 13746779 missense probably benign 0.03
R5591:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5592:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5593:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13759397 missense probably benign 0.00
R5644:Lyst UTSW 13 13637496 missense possibly damaging 0.58
R5659:Lyst UTSW 13 13634627 missense possibly damaging 0.58
R5741:Lyst UTSW 13 13634030 missense probably benign 0.44
R5908:Lyst UTSW 13 13696761 nonsense probably null
R5969:Lyst UTSW 13 13687813 splice site probably null
R6128:Lyst UTSW 13 13759379 missense possibly damaging 0.67
R6271:Lyst UTSW 13 13658754 missense probably benign 0.30
R6315:Lyst UTSW 13 13643504 missense probably benign
R6318:Lyst UTSW 13 13743311 missense possibly damaging 0.88
R6555:Lyst UTSW 13 13648925 missense probably benign 0.01
R6663:Lyst UTSW 13 13664116 splice site probably null
R6701:Lyst UTSW 13 13681485 missense probably benign 0.06
R6711:Lyst UTSW 13 13635235 missense possibly damaging 0.80
R6909:Lyst UTSW 13 13743375 missense probably damaging 1.00
R6915:Lyst UTSW 13 13726044 missense probably benign 0.01
R6929:Lyst UTSW 13 13743324 missense probably damaging 1.00
R6960:Lyst UTSW 13 13634078 missense probably benign 0.12
R7018:Lyst UTSW 13 13743459 critical splice donor site probably null
R7037:Lyst UTSW 13 13616666 missense probably damaging 1.00
R7045:Lyst UTSW 13 13634900 missense probably benign 0.34
R7045:Lyst UTSW 13 13637708 missense probably damaging 1.00
R7070:Lyst UTSW 13 13757444 missense probably benign 0.23
R7188:Lyst UTSW 13 13752090 missense possibly damaging 0.66
R7201:Lyst UTSW 13 13709300 nonsense probably null
R7210:Lyst UTSW 13 13656983 missense probably damaging 1.00
R7229:Lyst UTSW 13 13643509 missense probably benign 0.00
R7293:Lyst UTSW 13 13680237 missense probably benign 0.01
R7318:Lyst UTSW 13 13757443 missense probably benign 0.13
R7344:Lyst UTSW 13 13706555 missense probably benign
R7426:Lyst UTSW 13 13637524 missense probably benign
R7522:Lyst UTSW 13 13647083 nonsense probably null
R7583:Lyst UTSW 13 13635887 missense probably damaging 1.00
R7606:Lyst UTSW 13 13637475 missense probably damaging 1.00
R7636:Lyst UTSW 13 13616747 critical splice donor site probably null
R7658:Lyst UTSW 13 13730476 missense possibly damaging 0.63
R7685:Lyst UTSW 13 13669865 missense probably benign 0.00
R7689:Lyst UTSW 13 13683223 critical splice donor site probably null
R7765:Lyst UTSW 13 13709532 missense possibly damaging 0.75
R7779:Lyst UTSW 13 13634543 missense probably damaging 1.00
R7871:Lyst UTSW 13 13636052 nonsense probably null
R7872:Lyst UTSW 13 13635865 missense probably benign 0.14
R7884:Lyst UTSW 13 13707683 missense probably benign 0.09
R7890:Lyst UTSW 13 13740569 missense probably damaging 0.99
R7948:Lyst UTSW 13 13746589 missense possibly damaging 0.59
R8048:Lyst UTSW 13 13687645 missense probably benign 0.12
R8165:Lyst UTSW 13 13698360 missense probably damaging 0.99
R8235:Lyst UTSW 13 13760738 missense possibly damaging 0.69
R8237:Lyst UTSW 13 13651732 missense probably benign 0.00
R8275:Lyst UTSW 13 13776082 missense probably benign 0.02
R8300:Lyst UTSW 13 13664058 missense possibly damaging 0.79
RF001:Lyst UTSW 13 13635841 missense probably benign
RF002:Lyst UTSW 13 13634363 missense probably benign 0.05
X0024:Lyst UTSW 13 13634448 missense probably benign 0.00
X0026:Lyst UTSW 13 13751970 missense probably damaging 0.99
Z1088:Lyst UTSW 13 13743433 missense probably benign 0.09
Z1176:Lyst UTSW 13 13640107 missense probably damaging 1.00
Z1176:Lyst UTSW 13 13777079 missense probably benign 0.27
Z1177:Lyst UTSW 13 13680134 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CCATCTGGTCAGGTTTCTGC -3'
(R):5'- ACTACACTGAGTGCTAGGGAAG -3'

Sequencing Primer
(F):5'- CCATCTGGTCAGGTTTCTGCAAAAG -3'
(R):5'- TGAGTGCTAGGGAAGAATTATGATTC -3'
Posted On2020-06-30