Incidental Mutation 'R8085:Kctd1'
ID 629628
Institutional Source Beutler Lab
Gene Symbol Kctd1
Ensembl Gene ENSMUSG00000036225
Gene Name potassium channel tetramerisation domain containing 1
Synonyms 4933402K10Rik
MMRRC Submission 067518-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8085 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 15101742-15284503 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 15140901 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 610 (I610F)
Ref Sequence ENSEMBL: ENSMUSP00000128070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025992] [ENSMUST00000168989]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000025992
AA Change: I14F

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025992
Gene: ENSMUSG00000036225
AA Change: I14F

DomainStartEndE-ValueType
BTB 38 140 5e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168989
AA Change: I610F

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128070
Gene: ENSMUSG00000036225
AA Change: I610F

DomainStartEndE-ValueType
low complexity region 14 44 N/A INTRINSIC
low complexity region 52 62 N/A INTRINSIC
low complexity region 70 101 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
low complexity region 217 234 N/A INTRINSIC
Pfam:DUF3504 278 435 2.6e-32 PFAM
low complexity region 482 503 N/A INTRINSIC
low complexity region 559 567 N/A INTRINSIC
BTB 634 736 5e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.0%
Validation Efficiency 99% (81/82)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 G T 9: 30,854,611 (GRCm39) R160L probably benign Het
Atp11b T C 3: 35,895,185 (GRCm39) S908P probably benign Het
AW146154 C T 7: 41,130,621 (GRCm39) G165D possibly damaging Het
AW146154 C A 7: 41,130,622 (GRCm39) G165C probably damaging Het
Cachd1 G A 4: 100,845,361 (GRCm39) G951D probably damaging Het
Clstn3 T C 6: 124,435,683 (GRCm39) N250D probably benign Het
Coch G C 12: 51,650,031 (GRCm39) G340A possibly damaging Het
Col18a1 A G 10: 76,924,741 (GRCm39) V226A unknown Het
Crocc2 G A 1: 93,130,578 (GRCm39) R953Q possibly damaging Het
Dgkh A T 14: 78,824,558 (GRCm39) probably null Het
Disp2 C T 2: 118,617,452 (GRCm39) L149F possibly damaging Het
Dpt T C 1: 164,650,756 (GRCm39) F186S probably damaging Het
Eif3l T G 15: 78,961,066 (GRCm39) Y40D probably damaging Het
Epha3 A C 16: 63,403,873 (GRCm39) Y743D probably damaging Het
Ercc6l2 A T 13: 63,992,367 (GRCm39) Y272F probably benign Het
Exoc2 G A 13: 31,124,686 (GRCm39) L9F probably damaging Het
Fkbp9 A G 6: 56,833,289 (GRCm39) T259A probably benign Het
Gm5622 A T 14: 51,895,201 (GRCm39) K120M probably damaging Het
Hectd1 A T 12: 51,795,679 (GRCm39) F2250Y probably damaging Het
Herc2 A G 7: 55,879,427 (GRCm39) I4682V probably benign Het
Hnf1a T C 5: 115,108,732 (GRCm39) T58A probably benign Het
Kif5a A T 10: 127,075,178 (GRCm39) D478E probably benign Het
Klf13 G T 7: 63,541,497 (GRCm39) A210E probably damaging Het
Klhl20 C A 1: 160,921,354 (GRCm39) G543C probably damaging Het
Krt78 T C 15: 101,855,715 (GRCm39) T699A possibly damaging Het
Lgr5 A T 10: 115,311,102 (GRCm39) D231E probably benign Het
Lonrf1 C A 8: 36,715,769 (GRCm39) G289W probably damaging Het
Lyst T C 13: 13,808,894 (GRCm39) L188P probably damaging Het
Mab21l2 T C 3: 86,455,393 (GRCm39) probably benign Het
Macf1 A G 4: 123,303,875 (GRCm39) V209A possibly damaging Het
Mctp1 A C 13: 76,972,972 (GRCm39) R658S probably benign Het
Mdfi T C 17: 48,127,042 (GRCm39) T178A probably damaging Het
Msln T A 17: 25,971,942 (GRCm39) K92* probably null Het
Msx3 T C 7: 139,627,998 (GRCm39) H113R unknown Het
Muc6 T A 7: 141,226,729 (GRCm39) T1433S unknown Het
Musk T A 4: 58,373,110 (GRCm39) S693R probably benign Het
Myh13 A G 11: 67,225,613 (GRCm39) K296R probably benign Het
Mylip A T 13: 45,563,928 (GRCm39) H427L possibly damaging Het
Nradd G T 9: 110,451,179 (GRCm39) T63K possibly damaging Het
Ntaq1 T G 15: 58,015,983 (GRCm39) probably null Het
Or5h17 A G 16: 58,820,432 (GRCm39) N128S probably benign Het
Or5p66 G T 7: 107,885,620 (GRCm39) Q238K probably benign Het
Osbp2 A G 11: 3,662,521 (GRCm39) L187P probably damaging Het
Oxct1 A G 15: 4,158,350 (GRCm39) D428G probably damaging Het
Oxsm G T 14: 16,242,439 (GRCm38) S110* probably null Het
Pard6a A G 8: 106,429,642 (GRCm39) Q230R probably damaging Het
Pkhd1 C A 1: 20,683,639 (GRCm39) W38L probably damaging Het
Plekhh2 A G 17: 84,905,384 (GRCm39) N1093D probably damaging Het
Rttn C T 18: 89,071,672 (GRCm39) Q1240* probably null Het
Serpina1d T C 12: 103,730,087 (GRCm39) E365G probably damaging Het
Sis A T 3: 72,814,462 (GRCm39) H1589Q probably damaging Het
Slc40a1 A T 1: 45,957,528 (GRCm39) I152N probably damaging Het
Slc44a5 C T 3: 153,928,414 (GRCm39) P59S probably damaging Het
Smarca4 T A 9: 21,570,108 (GRCm39) probably null Het
Smim33 A T 18: 35,861,573 (GRCm39) D19V probably benign Het
Spag9 A G 11: 93,989,870 (GRCm39) Y930C probably benign Het
Speg A G 1: 75,391,997 (GRCm39) E1593G probably damaging Het
St3gal5 G T 6: 72,074,925 (GRCm39) A62S unknown Het
Stx1a T C 5: 135,066,431 (GRCm39) probably null Het
Syne1 T A 10: 5,178,021 (GRCm39) I4818F possibly damaging Het
Tango6 A G 8: 107,447,366 (GRCm39) H588R probably benign Het
Tapt1 T C 5: 44,336,307 (GRCm39) Y454C probably damaging Het
Tep1 A G 14: 51,066,753 (GRCm39) Y2282H probably benign Het
Tle6 A T 10: 81,431,792 (GRCm39) W151R probably damaging Het
Tmem131l A T 3: 83,834,438 (GRCm39) M715K possibly damaging Het
Ubr1 T A 2: 120,764,898 (GRCm39) R519* probably null Het
Usp1 A T 4: 98,816,578 (GRCm39) N93I probably damaging Het
Vmn1r211 A T 13: 23,035,953 (GRCm39) M238K probably damaging Het
Vmn1r238 A G 18: 3,123,151 (GRCm39) Y88H probably damaging Het
Vmn2r62 A G 7: 42,437,270 (GRCm39) Y405H probably damaging Het
Vmn2r78 A G 7: 86,603,998 (GRCm39) I725M probably benign Het
Zfp12 C T 5: 143,230,681 (GRCm39) T368M probably damaging Het
Other mutations in Kctd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kctd1 APN 18 15,195,747 (GRCm39) missense possibly damaging 0.51
IGL01402:Kctd1 APN 18 15,102,610 (GRCm39) missense probably damaging 0.98
IGL01404:Kctd1 APN 18 15,102,610 (GRCm39) missense probably damaging 0.98
IGL01755:Kctd1 APN 18 15,195,694 (GRCm39) missense possibly damaging 0.86
IGL02606:Kctd1 APN 18 15,195,937 (GRCm39) missense possibly damaging 0.73
IGL02725:Kctd1 APN 18 15,102,667 (GRCm39) missense possibly damaging 0.67
IGL02946:Kctd1 APN 18 15,107,036 (GRCm39) critical splice donor site probably null
R0128:Kctd1 UTSW 18 15,107,237 (GRCm39) missense probably benign 0.00
R0598:Kctd1 UTSW 18 15,140,822 (GRCm39) missense probably damaging 1.00
R1398:Kctd1 UTSW 18 15,195,654 (GRCm39) missense possibly damaging 0.85
R1669:Kctd1 UTSW 18 15,195,517 (GRCm39) missense possibly damaging 0.71
R1701:Kctd1 UTSW 18 15,102,617 (GRCm39) missense possibly damaging 0.95
R1745:Kctd1 UTSW 18 15,196,263 (GRCm39) intron probably benign
R1779:Kctd1 UTSW 18 15,194,839 (GRCm39) missense probably benign 0.01
R2083:Kctd1 UTSW 18 15,107,112 (GRCm39) missense possibly damaging 0.89
R2389:Kctd1 UTSW 18 15,195,268 (GRCm39) missense possibly damaging 0.73
R3010:Kctd1 UTSW 18 15,107,143 (GRCm39) missense probably damaging 1.00
R4576:Kctd1 UTSW 18 15,140,757 (GRCm39) missense probably damaging 1.00
R4673:Kctd1 UTSW 18 15,196,284 (GRCm39) intron probably benign
R4884:Kctd1 UTSW 18 15,107,311 (GRCm39) missense probably damaging 1.00
R4961:Kctd1 UTSW 18 15,195,580 (GRCm39) missense probably damaging 0.97
R5169:Kctd1 UTSW 18 15,195,822 (GRCm39) missense possibly damaging 0.72
R5398:Kctd1 UTSW 18 15,195,322 (GRCm39) missense possibly damaging 0.86
R5695:Kctd1 UTSW 18 15,196,573 (GRCm39) intron probably benign
R5893:Kctd1 UTSW 18 15,102,745 (GRCm39) missense possibly damaging 0.93
R6175:Kctd1 UTSW 18 15,102,688 (GRCm39) nonsense probably null
R6767:Kctd1 UTSW 18 15,195,232 (GRCm39) missense possibly damaging 0.53
R6852:Kctd1 UTSW 18 15,119,401 (GRCm39) missense possibly damaging 0.72
R6889:Kctd1 UTSW 18 15,107,045 (GRCm39) missense probably damaging 1.00
R7189:Kctd1 UTSW 18 15,195,700 (GRCm39) missense possibly damaging 0.71
R7228:Kctd1 UTSW 18 15,195,469 (GRCm39) missense possibly damaging 0.95
R7688:Kctd1 UTSW 18 15,107,255 (GRCm39) missense probably benign 0.03
R8195:Kctd1 UTSW 18 15,196,300 (GRCm39) missense unknown
R8496:Kctd1 UTSW 18 15,107,228 (GRCm39) missense probably damaging 1.00
R8924:Kctd1 UTSW 18 15,102,745 (GRCm39) missense possibly damaging 0.93
R8978:Kctd1 UTSW 18 15,119,491 (GRCm39) missense
R9094:Kctd1 UTSW 18 15,195,369 (GRCm39) missense possibly damaging 0.71
R9255:Kctd1 UTSW 18 15,194,853 (GRCm39) missense probably benign 0.00
R9629:Kctd1 UTSW 18 15,196,611 (GRCm39) missense unknown
R9680:Kctd1 UTSW 18 15,140,822 (GRCm39) missense probably damaging 1.00
Z1176:Kctd1 UTSW 18 15,196,182 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ATGCACTTCTGAGAATGACATCAC -3'
(R):5'- CCCTGAGCACGTGAAGTTTTC -3'

Sequencing Primer
(F):5'- ATGACATCACTTTTGCAGTTACCTGG -3'
(R):5'- GAGCACGTGAAGTTTTCTTTCTC -3'
Posted On 2020-06-30