Incidental Mutation 'R8085:Rttn'
ID629630
Institutional Source Beutler Lab
Gene Symbol Rttn
Ensembl Gene ENSMUSG00000023066
Gene Namerotatin
SynonymsC530033I08Rik, 4921538A15Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_175542.3; MGI:2179288

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8085 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location88971790-89131013 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 89053548 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1240 (Q1240*)
Ref Sequence ENSEMBL: ENSMUSP00000023828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023828]
Predicted Effect probably null
Transcript: ENSMUST00000023828
AA Change: Q1240*
SMART Domains Protein: ENSMUSP00000023828
Gene: ENSMUSG00000023066
AA Change: Q1240*

DomainStartEndE-ValueType
Pfam:RTTN_N 16 112 1.2e-36 PFAM
low complexity region 188 199 N/A INTRINSIC
Blast:ARM 216 261 9e-18 BLAST
low complexity region 302 319 N/A INTRINSIC
low complexity region 335 341 N/A INTRINSIC
SCOP:d1gw5a_ 515 952 9e-3 SMART
Blast:ARM 863 910 4e-8 BLAST
low complexity region 972 985 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1213 1222 N/A INTRINSIC
low complexity region 1680 1698 N/A INTRINSIC
low complexity region 1861 1879 N/A INTRINSIC
Blast:ARM 2088 2129 1e-10 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.0%
Validation Efficiency 99% (81/82)
MGI Phenotype Strain: 2674124
Lethality: E9-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein whose specific function is unknown. Absence of the orthologous protein in mouse results in embryonic lethality with deficient axial rotation, abnormal differentiation of the neural tube, and randomized looping of the heart tube during development. In human, mutations in this gene are associated with polymicrogyria with seizures. In human fibroblasts this protein localizes at the ciliary basal bodies. Given the intracellular localization of this protein and the phenotypic effects of mutations, this gene is suspected of playing a role in the maintenance of normal ciliary structure which in turn effects the developmental process of left-right organ specification, axial rotation, and perhaps notochord development. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for an insertional mutation exhibit embryonic lethality and neurulation defects resulting in the arrest of gastrulation movements and abnormal left-right specification in the heart. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted(2) Gene trapped(12) Transgenic(1)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066B19Rik A T 18: 35,728,520 D19V probably benign Het
Adamts8 G T 9: 30,943,315 R160L probably benign Het
Atp11b T C 3: 35,841,036 S908P probably benign Het
AW146154 C T 7: 41,481,197 G165D possibly damaging Het
AW146154 C A 7: 41,481,198 G165C probably damaging Het
Cachd1 G A 4: 100,988,164 G951D probably damaging Het
Clstn3 T C 6: 124,458,724 N250D probably benign Het
Coch G C 12: 51,603,248 G340A possibly damaging Het
Col18a1 A G 10: 77,088,907 V226A unknown Het
Crocc2 G A 1: 93,202,856 R953Q possibly damaging Het
Dgkh A T 14: 78,587,118 probably null Het
Disp2 C T 2: 118,786,971 L149F possibly damaging Het
Dpt T C 1: 164,823,187 F186S probably damaging Het
Eif3l T G 15: 79,076,866 Y40D probably damaging Het
Epha3 A C 16: 63,583,510 Y743D probably damaging Het
Ercc6l2 A T 13: 63,844,553 Y272F probably benign Het
Exoc2 G A 13: 30,940,703 L9F probably damaging Het
Fkbp9 A G 6: 56,856,304 T259A probably benign Het
Gm5622 A T 14: 51,657,744 K120M probably damaging Het
Hectd1 A T 12: 51,748,896 F2250Y probably damaging Het
Herc2 A G 7: 56,229,679 I4682V probably benign Het
Hnf1a T C 5: 114,970,673 T58A probably benign Het
Kctd1 T A 18: 15,007,844 I610F possibly damaging Het
Kif5a A T 10: 127,239,309 D478E probably benign Het
Klf13 G T 7: 63,891,749 A210E probably damaging Het
Klhl20 C A 1: 161,093,784 G543C probably damaging Het
Krt78 T C 15: 101,947,280 T699A possibly damaging Het
Lgr5 A T 10: 115,475,197 D231E probably benign Het
Lonrf1 C A 8: 36,248,615 G289W probably damaging Het
Lyst T C 13: 13,634,309 L188P probably damaging Het
Mab21l2 T C 3: 86,548,086 probably benign Het
Macf1 A G 4: 123,410,082 V209A possibly damaging Het
Mctp1 A C 13: 76,824,853 R658S probably benign Het
Mdfi T C 17: 47,816,117 T178A probably damaging Het
Msln T A 17: 25,752,968 K92* probably null Het
Msx3 T C 7: 140,048,085 H113R unknown Het
Muc6 T A 7: 141,640,462 T1433S unknown Het
Musk T A 4: 58,373,110 S693R probably benign Het
Myh13 A G 11: 67,334,787 K296R probably benign Het
Mylip A T 13: 45,410,452 H427L possibly damaging Het
Nradd G T 9: 110,622,111 T63K possibly damaging Het
Olfr183 A G 16: 59,000,069 N128S probably benign Het
Olfr490 G T 7: 108,286,413 Q238K probably benign Het
Osbp2 A G 11: 3,712,521 L187P probably damaging Het
Oxct1 A G 15: 4,128,868 D428G probably damaging Het
Oxsm G T 14: 16,242,439 S110* probably null Het
Pard6a A G 8: 105,703,010 Q230R probably damaging Het
Pkhd1 C A 1: 20,613,415 W38L probably damaging Het
Plekhh2 A G 17: 84,597,956 N1093D probably damaging Het
Serpina1d T C 12: 103,763,828 E365G probably damaging Het
Sis A T 3: 72,907,129 H1589Q probably damaging Het
Slc40a1 A T 1: 45,918,368 I152N probably damaging Het
Slc44a5 C T 3: 154,222,777 P59S probably damaging Het
Smarca4 T A 9: 21,658,812 probably null Het
Spag9 A G 11: 94,099,044 Y930C probably benign Het
Speg A G 1: 75,415,353 E1593G probably damaging Het
St3gal5 G T 6: 72,097,941 A62S unknown Het
Stx1a T C 5: 135,037,577 probably null Het
Syne1 T A 10: 5,228,021 I4818F possibly damaging Het
Tango6 A G 8: 106,720,734 H588R probably benign Het
Tapt1 T C 5: 44,178,965 Y454C probably damaging Het
Tep1 A G 14: 50,829,296 Y2282H probably benign Het
Tle6 A T 10: 81,595,958 W151R probably damaging Het
Tmem131l A T 3: 83,927,131 M715K possibly damaging Het
Ubr1 T A 2: 120,934,417 R519* probably null Het
Usp1 A T 4: 98,928,341 N93I probably damaging Het
Vmn1r211 A T 13: 22,851,783 M238K probably damaging Het
Vmn1r238 A G 18: 3,123,151 Y88H probably damaging Het
Vmn2r62 A G 7: 42,787,846 Y405H probably damaging Het
Vmn2r78 A G 7: 86,954,790 I725M probably benign Het
Wdyhv1 T G 15: 58,152,587 probably null Het
Zfp12 C T 5: 143,244,926 T368M probably damaging Het
Other mutations in Rttn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Rttn APN 18 88974340 missense probably benign 0.00
IGL00788:Rttn APN 18 88972509 missense probably benign 0.00
IGL00929:Rttn APN 18 89028935 missense probably damaging 1.00
IGL01392:Rttn APN 18 88995613 missense probably benign 0.03
IGL01395:Rttn APN 18 89129770 missense possibly damaging 0.89
IGL01701:Rttn APN 18 89064215 missense probably damaging 1.00
IGL02136:Rttn APN 18 89046128 missense possibly damaging 0.87
IGL02151:Rttn APN 18 89020205 missense probably damaging 1.00
IGL02165:Rttn APN 18 89043041 missense probably benign
IGL02228:Rttn APN 18 89042231 missense probably damaging 1.00
IGL02276:Rttn APN 18 89048454 missense possibly damaging 0.94
IGL02612:Rttn APN 18 88973626 missense probably damaging 1.00
IGL02645:Rttn APN 18 89110686 missense probably benign 0.04
IGL02716:Rttn APN 18 89048417 missense possibly damaging 0.77
IGL02820:Rttn APN 18 89028998 missense probably damaging 1.00
IGL02961:Rttn APN 18 89053573 missense probably damaging 1.00
IGL02973:Rttn APN 18 88972494 missense probably damaging 1.00
IGL03027:Rttn APN 18 88979690 missense probably damaging 1.00
IGL03082:Rttn APN 18 88983948 missense probably damaging 1.00
IGL03121:Rttn APN 18 88975751 missense probably damaging 1.00
IGL03135:Rttn APN 18 89015150 missense probably damaging 1.00
IGL03328:Rttn APN 18 89043028 missense probably benign 0.19
Fascisti UTSW 18 89009460 splice site probably benign
marcher UTSW 18 89037946 missense probably damaging 0.99
militaristi UTSW 18 89010916 missense probably damaging 1.00
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0310:Rttn UTSW 18 89009460 splice site probably benign
R0330:Rttn UTSW 18 88986080 splice site probably null
R0363:Rttn UTSW 18 89010955 missense probably damaging 1.00
R0485:Rttn UTSW 18 89090419 splice site probably benign
R0590:Rttn UTSW 18 88979635 missense probably damaging 1.00
R0601:Rttn UTSW 18 89042966 missense probably benign 0.00
R0604:Rttn UTSW 18 88977758 missense probably damaging 1.00
R0631:Rttn UTSW 18 88989546 missense probably benign 0.00
R0882:Rttn UTSW 18 88973689 nonsense probably null
R0885:Rttn UTSW 18 88983810 missense probably benign 0.03
R0900:Rttn UTSW 18 89101691 missense probably benign 0.13
R1077:Rttn UTSW 18 89064249 missense probably damaging 1.00
R1444:Rttn UTSW 18 89042867 missense probably benign 0.04
R1460:Rttn UTSW 18 89109357 splice site probably benign
R1517:Rttn UTSW 18 89113350 missense probably benign 0.01
R1630:Rttn UTSW 18 89042954 missense probably benign 0.02
R1632:Rttn UTSW 18 89009336 missense probably benign 0.18
R1722:Rttn UTSW 18 88973531 missense probably benign 0.34
R1755:Rttn UTSW 18 89009317 missense probably damaging 1.00
R1881:Rttn UTSW 18 89015212 missense probably damaging 0.96
R1971:Rttn UTSW 18 89090433 missense probably benign
R2035:Rttn UTSW 18 89020216 missense probably damaging 1.00
R2109:Rttn UTSW 18 88986073 missense possibly damaging 0.93
R2191:Rttn UTSW 18 89095648 critical splice donor site probably null
R2201:Rttn UTSW 18 89010943 missense possibly damaging 0.88
R2266:Rttn UTSW 18 89064171 missense probably benign 0.05
R3014:Rttn UTSW 18 89014620 missense probably damaging 1.00
R3052:Rttn UTSW 18 89015246 splice site probably benign
R3427:Rttn UTSW 18 89095651 splice site probably null
R3431:Rttn UTSW 18 89095571 missense probably benign 0.04
R3786:Rttn UTSW 18 89037894 missense probably benign 0.00
R3803:Rttn UTSW 18 88977707 missense probably damaging 0.96
R3980:Rttn UTSW 18 89017275 missense probably benign 0.12
R4035:Rttn UTSW 18 88995653 missense probably benign 0.03
R4170:Rttn UTSW 18 88975723 missense probably damaging 1.00
R4223:Rttn UTSW 18 89095584 missense probably damaging 1.00
R4273:Rttn UTSW 18 89091896 missense probably benign
R4517:Rttn UTSW 18 89028973 missense probably damaging 0.99
R4674:Rttn UTSW 18 89011011 splice site probably null
R4837:Rttn UTSW 18 89090415 splice site probably null
R4869:Rttn UTSW 18 89043014 nonsense probably null
R4881:Rttn UTSW 18 89101685 missense probably damaging 1.00
R4959:Rttn UTSW 18 89042168 missense probably damaging 1.00
R4973:Rttn UTSW 18 89042168 missense probably damaging 1.00
R4975:Rttn UTSW 18 89064085 splice site probably null
R5166:Rttn UTSW 18 89013094 missense possibly damaging 0.48
R5243:Rttn UTSW 18 89108063 missense possibly damaging 0.74
R5594:Rttn UTSW 18 89090436 missense possibly damaging 0.95
R5654:Rttn UTSW 18 89048432 missense probably benign
R5794:Rttn UTSW 18 88995569 missense probably benign 0.18
R5799:Rttn UTSW 18 89037946 missense probably damaging 0.99
R5955:Rttn UTSW 18 89121009 missense probably damaging 0.99
R5963:Rttn UTSW 18 89073695 missense probably benign 0.01
R5989:Rttn UTSW 18 88973626 missense probably damaging 1.00
R6004:Rttn UTSW 18 89021692 missense probably damaging 0.96
R6132:Rttn UTSW 18 89115646 critical splice donor site probably null
R6430:Rttn UTSW 18 89021685 missense probably null 0.18
R6436:Rttn UTSW 18 89110729 missense probably damaging 1.00
R6681:Rttn UTSW 18 89014611 missense probably damaging 1.00
R6994:Rttn UTSW 18 89028899 missense probably damaging 1.00
R7049:Rttn UTSW 18 89064216 missense probably damaging 1.00
R7078:Rttn UTSW 18 89009422 missense probably benign 0.03
R7083:Rttn UTSW 18 89090598 missense probably damaging 1.00
R7250:Rttn UTSW 18 88989523 missense probably benign 0.03
R7402:Rttn UTSW 18 88985911 missense possibly damaging 0.92
R7565:Rttn UTSW 18 89060479 missense probably damaging 1.00
R7588:Rttn UTSW 18 89064229 missense probably damaging 0.97
R8029:Rttn UTSW 18 89090474 missense not run
R8113:Rttn UTSW 18 89010916 missense probably damaging 1.00
X0017:Rttn UTSW 18 89113402 missense probably benign 0.01
X0022:Rttn UTSW 18 88973667 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTATCTGCTTCATTACAGGGTGG -3'
(R):5'- AGTACTTCCCACAAATCTCAAGTG -3'

Sequencing Primer
(F):5'- GGTAATGCCACTATGTACTTTAATGC -3'
(R):5'- CCACAAATCTCAAGTGGCTTTG -3'
Posted On2020-06-30