Incidental Mutation 'R8086:Lrrfip1'
ID629632
Institutional Source Beutler Lab
Gene Symbol Lrrfip1
Ensembl Gene ENSMUSG00000026305
Gene Nameleucine rich repeat (in FLII) interacting protein 1
SynonymsFliiap1, FLAP (FLI LRR associated protein)
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8086 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location90998737-91128944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91115908 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 678 (H678Q)
Ref Sequence ENSEMBL: ENSMUSP00000095254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068116] [ENSMUST00000068167] [ENSMUST00000097649] [ENSMUST00000097650] [ENSMUST00000185531] [ENSMUST00000189617]
Predicted Effect probably benign
Transcript: ENSMUST00000068116
SMART Domains Protein: ENSMUSP00000065850
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 33 354 4.1e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068167
SMART Domains Protein: ENSMUSP00000063878
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 23 123 2.2e-18 PFAM
Pfam:DUF2051 193 387 2.5e-49 PFAM
Pfam:DUF2051 366 553 8.1e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097649
AA Change: H678Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000095254
Gene: ENSMUSG00000026305
AA Change: H678Q

DomainStartEndE-ValueType
Pfam:DUF2051 23 327 1.3e-87 PFAM
internal_repeat_2 439 528 6e-5 PROSPERO
low complexity region 550 566 N/A INTRINSIC
internal_repeat_2 575 683 6e-5 PROSPERO
internal_repeat_1 647 715 1.05e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000097650
SMART Domains Protein: ENSMUSP00000095255
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 23 120 2.3e-16 PFAM
Pfam:DUF2051 195 368 1.2e-63 PFAM
Pfam:DUF2051 379 554 1.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185531
SMART Domains Protein: ENSMUSP00000139497
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 33 118 1.2e-12 PFAM
low complexity region 138 158 N/A INTRINSIC
Pfam:DUF2051 231 413 3.7e-60 PFAM
Pfam:DUF2051 424 575 1.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189617
SMART Domains Protein: ENSMUSP00000139811
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 23 108 1.4e-12 PFAM
low complexity region 128 148 N/A INTRINSIC
Pfam:DUF2051 229 403 1.2e-60 PFAM
Pfam:DUF2051 414 589 1.8e-44 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,178 H372L Het
4931423N10Rik A G 2: 23,240,922 probably null Het
Abcb1a A T 5: 8,674,833 T89S probably benign Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Capn9 A T 8: 124,607,953 probably null Het
Cox4i1 T A 8: 120,674,040 M148K probably damaging Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dnajc3 G T 14: 118,970,780 E276* probably null Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hinfp C T 9: 44,298,989 R183Q probably damaging Het
Hpd T C 5: 123,176,189 Y221C probably benign Het
Hrnr A T 3: 93,323,421 H322L unknown Het
Il6st T A 13: 112,494,560 probably null Het
Impa1 T C 3: 10,322,928 K145E probably benign Het
Itga9 A T 9: 118,850,801 M847L probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Mettl16 A G 11: 74,805,265 T311A probably benign Het
Nefl T C 14: 68,086,031 Y369H probably damaging Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Ramp2 T A 11: 101,247,936 L147Q probably damaging Het
Rassf1 C T 9: 107,557,974 R223C probably benign Het
Rcbtb2 T C 14: 73,173,865 F357L probably damaging Het
Rnf24 A G 2: 131,303,548 V114A probably benign Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tatdn2 T C 6: 113,709,521 S697P probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r237 T G 17: 21,314,247 D77E possibly damaging Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in Lrrfip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Lrrfip1 APN 1 91068621 missense probably damaging 1.00
IGL00835:Lrrfip1 APN 1 91115418 missense possibly damaging 0.89
IGL01603:Lrrfip1 APN 1 91115913 missense probably benign 0.03
IGL02261:Lrrfip1 APN 1 91112168 missense probably benign 0.22
IGL02401:Lrrfip1 APN 1 91114928 missense probably benign 0.21
IGL02690:Lrrfip1 APN 1 91053661 missense probably damaging 0.97
R0048:Lrrfip1 UTSW 1 91093647 splice site probably benign
R0048:Lrrfip1 UTSW 1 91093647 splice site probably benign
R0891:Lrrfip1 UTSW 1 91068615 missense probably damaging 1.00
R1210:Lrrfip1 UTSW 1 91115193 missense probably benign 0.16
R1352:Lrrfip1 UTSW 1 91115367 missense probably benign
R1488:Lrrfip1 UTSW 1 91114632 missense probably damaging 1.00
R1600:Lrrfip1 UTSW 1 91114667 missense probably damaging 0.98
R1718:Lrrfip1 UTSW 1 91115555 missense probably damaging 0.99
R2056:Lrrfip1 UTSW 1 91115817 missense probably benign 0.25
R2993:Lrrfip1 UTSW 1 91105234 missense probably damaging 0.99
R3782:Lrrfip1 UTSW 1 91112189 missense possibly damaging 0.82
R4191:Lrrfip1 UTSW 1 91110399 missense probably benign 0.39
R4675:Lrrfip1 UTSW 1 91103320 critical splice donor site probably null
R4732:Lrrfip1 UTSW 1 91115647 missense probably benign 0.29
R4733:Lrrfip1 UTSW 1 91115647 missense probably benign 0.29
R5196:Lrrfip1 UTSW 1 91114608 missense probably damaging 1.00
R5250:Lrrfip1 UTSW 1 91115896 missense possibly damaging 0.90
R5433:Lrrfip1 UTSW 1 91087126 critical splice donor site probably null
R6005:Lrrfip1 UTSW 1 91114611 missense probably damaging 1.00
R6218:Lrrfip1 UTSW 1 91082159 missense probably damaging 0.96
R6600:Lrrfip1 UTSW 1 91115847 missense probably damaging 0.99
R6847:Lrrfip1 UTSW 1 91105128 missense probably damaging 1.00
R6911:Lrrfip1 UTSW 1 91114807 nonsense probably null
R6940:Lrrfip1 UTSW 1 91122413 splice site probably null
R6976:Lrrfip1 UTSW 1 91115015 missense probably benign 0.00
R7002:Lrrfip1 UTSW 1 91115458 missense probably benign 0.31
R7205:Lrrfip1 UTSW 1 91091616 missense probably benign 0.00
R7363:Lrrfip1 UTSW 1 91123120 missense probably benign 0.05
R7552:Lrrfip1 UTSW 1 91105283 missense probably damaging 1.00
R7910:Lrrfip1 UTSW 1 91120152 missense possibly damaging 0.88
R8006:Lrrfip1 UTSW 1 91076951 missense probably damaging 1.00
R8068:Lrrfip1 UTSW 1 91128102 missense probably damaging 1.00
R8221:Lrrfip1 UTSW 1 91115156 missense probably benign 0.11
R8352:Lrrfip1 UTSW 1 90998819 missense probably benign
R8362:Lrrfip1 UTSW 1 91053701 missense probably damaging 1.00
X0057:Lrrfip1 UTSW 1 91115403 missense possibly damaging 0.67
Z1088:Lrrfip1 UTSW 1 91115530 intron probably benign
Z1176:Lrrfip1 UTSW 1 91101199 missense possibly damaging 0.66
Z1177:Lrrfip1 UTSW 1 91122494 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TCCTCAAAGTGGGTCGAGTG -3'
(R):5'- TAAACCTCAGCAGGGCAGTG -3'

Sequencing Primer
(F):5'- CTCAAAGTGGGTCGAGTGGAAAAC -3'
(R):5'- GAGCTTACTGGGCTAAGTCTCC -3'
Posted On2020-06-30