Incidental Mutation 'R8086:Rnf24'
ID629637
Institutional Source Beutler Lab
Gene Symbol Rnf24
Ensembl Gene ENSMUSG00000048911
Gene Namering finger protein 24
SynonymsC86507, 2810473M14Rik, D2Ertd504e, 4930505A13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8086 (G1)
Quality Score215.009
Status Validated
Chromosome2
Chromosomal Location131298064-131352892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131303548 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 114 (V114A)
Ref Sequence ENSEMBL: ENSMUSP00000058630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059372] [ENSMUST00000110194] [ENSMUST00000150843] [ENSMUST00000165420] [ENSMUST00000183902] [ENSMUST00000184932]
Predicted Effect probably benign
Transcript: ENSMUST00000059372
AA Change: V114A

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000058630
Gene: ENSMUSG00000048911
AA Change: V114A

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
RING 78 118 2.71e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110194
AA Change: V114A

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105823
Gene: ENSMUSG00000048911
AA Change: V114A

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
RING 78 118 2.71e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150843
SMART Domains Protein: ENSMUSP00000119606
Gene: ENSMUSG00000037514

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 28 54 N/A INTRINSIC
Pfam:Fumble 86 438 8.8e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165420
AA Change: V114A

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129843
Gene: ENSMUSG00000048911
AA Change: V114A

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
RING 78 118 2.71e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183902
SMART Domains Protein: ENSMUSP00000139130
Gene: ENSMUSG00000048911

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184932
SMART Domains Protein: ENSMUSP00000139259
Gene: ENSMUSG00000037514

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 28 54 N/A INTRINSIC
Pfam:Fumble 85 151 1e-12 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that contains a RING-type zinc finger. The encoded protein may interact with multiple transient receptor potential cation channel subfamily C (TRPC) proteins and regulate the trafficking and insertion of these proteins into the plasma membrane. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,178 H372L Het
4931423N10Rik A G 2: 23,240,922 probably null Het
Abcb1a A T 5: 8,674,833 T89S probably benign Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Capn9 A T 8: 124,607,953 probably null Het
Cox4i1 T A 8: 120,674,040 M148K probably damaging Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dnajc3 G T 14: 118,970,780 E276* probably null Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hinfp C T 9: 44,298,989 R183Q probably damaging Het
Hpd T C 5: 123,176,189 Y221C probably benign Het
Hrnr A T 3: 93,323,421 H322L unknown Het
Il6st T A 13: 112,494,560 probably null Het
Impa1 T C 3: 10,322,928 K145E probably benign Het
Itga9 A T 9: 118,850,801 M847L probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Lrrfip1 T A 1: 91,115,908 H678Q probably benign Het
Mettl16 A G 11: 74,805,265 T311A probably benign Het
Nefl T C 14: 68,086,031 Y369H probably damaging Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Ramp2 T A 11: 101,247,936 L147Q probably damaging Het
Rassf1 C T 9: 107,557,974 R223C probably benign Het
Rcbtb2 T C 14: 73,173,865 F357L probably damaging Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tatdn2 T C 6: 113,709,521 S697P probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r237 T G 17: 21,314,247 D77E possibly damaging Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in Rnf24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Rnf24 APN 2 131305693 missense possibly damaging 0.46
R5888:Rnf24 UTSW 2 131322245 intron probably benign
R7444:Rnf24 UTSW 2 131313295 missense probably damaging 1.00
R7661:Rnf24 UTSW 2 131322215 intron probably benign
R7737:Rnf24 UTSW 2 131303496 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAACGGAGTCTGCTTGTGTTC -3'
(R):5'- TGGTACCTTCACATCAGCCTG -3'

Sequencing Primer
(F):5'- CCTCCTGGCTCCATACTGATGTG -3'
(R):5'- CTTCACATCAGCCTGTAGGAGATAG -3'
Posted On2020-06-30