Incidental Mutation 'R8086:Impa1'
ID629638
Institutional Source Beutler Lab
Gene Symbol Impa1
Ensembl Gene ENSMUSG00000027531
Gene Nameinositol (myo)-1(or 4)-monophosphatase 1
Synonymslithium-sensitive myo-inositol monophosphatase A1, 2900059K10Rik, 2610002K09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8086 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location10311956-10331439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10322928 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 145 (K145E)
Ref Sequence ENSEMBL: ENSMUSP00000068174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065938] [ENSMUST00000118410] [ENSMUST00000128912] [ENSMUST00000191670] [ENSMUST00000192603]
Predicted Effect probably benign
Transcript: ENSMUST00000065938
AA Change: K145E

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000068174
Gene: ENSMUSG00000027531
AA Change: K145E

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 1.5e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118410
AA Change: K145E

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113860
Gene: ENSMUSG00000027531
AA Change: K145E

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 7.7e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128912
SMART Domains Protein: ENSMUSP00000116088
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 19 90 4.4e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000191670
AA Change: K145E

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141345
Gene: ENSMUSG00000027531
AA Change: K145E

DomainStartEndE-ValueType
Pfam:Inositol_P 5 180 4.7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192603
SMART Domains Protein: ENSMUSP00000141735
Gene: ENSMUSG00000103392

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Meta Mutation Damage Score 0.1991 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that dephosphorylates myo-inositol monophosphate to generate free myo-inositol, a precursor of phosphatidylinositol, and is therefore an important modulator of intracellular signal transduction via the production of the second messengers myoinositol 1,4,5-trisphosphate and diacylglycerol. This enzyme can also use myo-inositol-1,3-diphosphate, myo-inositol-1,4-diphosphate, scyllo-inositol-phosphate, glucose-1-phosphate, glucose-6-phosphate, fructose-1-phosphate, beta-glycerophosphate, and 2'-AMP as substrates. This enzyme shows magnesium-dependent phosphatase activity and is inhibited by therapeutic concentrations of lithium. Inhibition of inositol monophosphate hydroylosis and subsequent depletion of inositol for phosphatidylinositol synthesis may explain the anti-manic and anti-depressive effects of lithium administered to treat bipolar disorder. Alternative splicing results in multiple transcript variants encoding distinct isoforms. A pseudogene of this gene is also present on chromosome 8q21.13. [provided by RefSeq, Dec 2014]
PHENOTYPE: Most mice homozygous for a knock-out allele die between E9.5 and E10.5 with surviving mice exhibiting hyperactivity, increased rearing, and increased susceptibility to pilocarpine-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,178 H372L Het
4931423N10Rik A G 2: 23,240,922 probably null Het
Abcb1a A T 5: 8,674,833 T89S probably benign Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Capn9 A T 8: 124,607,953 probably null Het
Cox4i1 T A 8: 120,674,040 M148K probably damaging Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dnajc3 G T 14: 118,970,780 E276* probably null Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hinfp C T 9: 44,298,989 R183Q probably damaging Het
Hpd T C 5: 123,176,189 Y221C probably benign Het
Hrnr A T 3: 93,323,421 H322L unknown Het
Il6st T A 13: 112,494,560 probably null Het
Itga9 A T 9: 118,850,801 M847L probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Lrrfip1 T A 1: 91,115,908 H678Q probably benign Het
Mettl16 A G 11: 74,805,265 T311A probably benign Het
Nefl T C 14: 68,086,031 Y369H probably damaging Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Ramp2 T A 11: 101,247,936 L147Q probably damaging Het
Rassf1 C T 9: 107,557,974 R223C probably benign Het
Rcbtb2 T C 14: 73,173,865 F357L probably damaging Het
Rnf24 A G 2: 131,303,548 V114A probably benign Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tatdn2 T C 6: 113,709,521 S697P probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r237 T G 17: 21,314,247 D77E possibly damaging Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in Impa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Impa1 APN 3 10322948 missense probably damaging 1.00
IGL02411:Impa1 APN 3 10322958 missense possibly damaging 0.90
IGL02733:Impa1 APN 3 10328965 missense probably benign
IGL03183:Impa1 APN 3 10322994 missense probably damaging 1.00
lofty UTSW 3 10329004 start codon destroyed probably null 1.00
olympian UTSW 3 10315280 missense probably damaging 1.00
R0166:Impa1 UTSW 3 10328960 missense probably damaging 0.99
R0782:Impa1 UTSW 3 10322896 splice site probably benign
R1645:Impa1 UTSW 3 10328441 missense possibly damaging 0.79
R3196:Impa1 UTSW 3 10329015 splice site probably null
R3905:Impa1 UTSW 3 10316034 missense probably benign
R4953:Impa1 UTSW 3 10315280 missense probably damaging 1.00
R5495:Impa1 UTSW 3 10326170 missense probably benign 0.08
R5884:Impa1 UTSW 3 10316224 missense probably damaging 1.00
R5972:Impa1 UTSW 3 10329004 start codon destroyed probably null 1.00
R6927:Impa1 UTSW 3 10315288 missense probably benign 0.00
R7605:Impa1 UTSW 3 10324087 missense probably damaging 0.96
R7801:Impa1 UTSW 3 10321667 missense probably benign
R8190:Impa1 UTSW 3 10321628 missense possibly damaging 0.48
X0054:Impa1 UTSW 3 10316100 splice site probably null
Z1177:Impa1 UTSW 3 10316074 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTTGCTCAACCGTATCTGC -3'
(R):5'- ACTGTGTTTGGGCAGTACTTCC -3'

Sequencing Primer
(F):5'- GCTCAACCGTATCTGCTTTTCTG -3'
(R):5'- GGCAGTACTTCCCCACAGTTCAG -3'
Posted On2020-06-30