Incidental Mutation 'R8086:Hrnr'
ID629639
Institutional Source Beutler Lab
Gene Symbol Hrnr
Ensembl Gene ENSMUSG00000041991
Gene Namehornerin
Synonyms1110033K19Rik, S100a18, A530063N20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8086 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location93319749-93333570 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93323421 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 322 (H322L)
Ref Sequence ENSEMBL: ENSMUSP00000091288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090856] [ENSMUST00000093774]
Predicted Effect unknown
Transcript: ENSMUST00000090856
AA Change: H322L
SMART Domains Protein: ENSMUSP00000088369
Gene: ENSMUSG00000041991
AA Change: H322L

DomainStartEndE-ValueType
Pfam:S_100 4 47 4.8e-15 PFAM
Blast:EFh 53 81 6e-9 BLAST
internal_repeat_5 95 129 7.19e-7 PROSPERO
low complexity region 135 155 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 200 246 N/A INTRINSIC
low complexity region 255 287 N/A INTRINSIC
internal_repeat_2 288 341 5.7e-19 PROSPERO
internal_repeat_1 291 354 5.27e-23 PROSPERO
internal_repeat_3 301 355 9.03e-17 PROSPERO
internal_repeat_5 309 343 7.19e-7 PROSPERO
low complexity region 358 379 N/A INTRINSIC
low complexity region 394 415 N/A INTRINSIC
low complexity region 421 498 N/A INTRINSIC
low complexity region 501 523 N/A INTRINSIC
low complexity region 527 593 N/A INTRINSIC
low complexity region 598 675 N/A INTRINSIC
low complexity region 679 713 N/A INTRINSIC
low complexity region 723 764 N/A INTRINSIC
low complexity region 769 846 N/A INTRINSIC
low complexity region 849 871 N/A INTRINSIC
low complexity region 875 941 N/A INTRINSIC
low complexity region 946 1023 N/A INTRINSIC
low complexity region 1027 1061 N/A INTRINSIC
low complexity region 1084 1112 N/A INTRINSIC
low complexity region 1117 1194 N/A INTRINSIC
low complexity region 1197 1219 N/A INTRINSIC
low complexity region 1223 1289 N/A INTRINSIC
low complexity region 1294 1371 N/A INTRINSIC
low complexity region 1375 1409 N/A INTRINSIC
low complexity region 1419 1460 N/A INTRINSIC
low complexity region 1465 1542 N/A INTRINSIC
low complexity region 1545 1567 N/A INTRINSIC
low complexity region 1571 1637 N/A INTRINSIC
low complexity region 1642 1719 N/A INTRINSIC
low complexity region 1723 1757 N/A INTRINSIC
low complexity region 1767 1808 N/A INTRINSIC
low complexity region 1813 1890 N/A INTRINSIC
low complexity region 1893 1915 N/A INTRINSIC
low complexity region 1919 1985 N/A INTRINSIC
low complexity region 1990 2067 N/A INTRINSIC
low complexity region 2071 2105 N/A INTRINSIC
low complexity region 2115 2156 N/A INTRINSIC
low complexity region 2161 2238 N/A INTRINSIC
low complexity region 2242 2327 N/A INTRINSIC
low complexity region 2332 2409 N/A INTRINSIC
low complexity region 2413 2447 N/A INTRINSIC
low complexity region 2457 2498 N/A INTRINSIC
low complexity region 2503 2580 N/A INTRINSIC
low complexity region 2583 2605 N/A INTRINSIC
low complexity region 2609 2675 N/A INTRINSIC
low complexity region 2680 2757 N/A INTRINSIC
low complexity region 2761 2795 N/A INTRINSIC
low complexity region 2805 2846 N/A INTRINSIC
low complexity region 2851 2896 N/A INTRINSIC
internal_repeat_4 2897 2968 4.19e-13 PROSPERO
internal_repeat_3 2901 2955 9.03e-17 PROSPERO
internal_repeat_2 2920 2967 5.7e-19 PROSPERO
low complexity region 2969 2985 N/A INTRINSIC
low complexity region 3016 3034 N/A INTRINSIC
internal_repeat_1 3039 3101 5.27e-23 PROSPERO
internal_repeat_4 3045 3103 4.19e-13 PROSPERO
low complexity region 3140 3153 N/A INTRINSIC
low complexity region 3163 3174 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000093774
AA Change: H322L
SMART Domains Protein: ENSMUSP00000091288
Gene: ENSMUSG00000041991
AA Change: H322L

DomainStartEndE-ValueType
Pfam:S_100 4 46 3.1e-17 PFAM
Blast:EFh 53 81 6e-9 BLAST
internal_repeat_5 95 129 5.9e-7 PROSPERO
low complexity region 135 155 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 200 246 N/A INTRINSIC
low complexity region 255 287 N/A INTRINSIC
internal_repeat_2 288 341 3.49e-19 PROSPERO
internal_repeat_1 291 354 2.93e-23 PROSPERO
internal_repeat_3 301 355 5.83e-17 PROSPERO
internal_repeat_5 309 343 5.9e-7 PROSPERO
low complexity region 358 379 N/A INTRINSIC
low complexity region 394 415 N/A INTRINSIC
low complexity region 421 498 N/A INTRINSIC
low complexity region 501 523 N/A INTRINSIC
low complexity region 527 593 N/A INTRINSIC
low complexity region 598 675 N/A INTRINSIC
low complexity region 679 713 N/A INTRINSIC
low complexity region 723 764 N/A INTRINSIC
low complexity region 769 846 N/A INTRINSIC
low complexity region 849 871 N/A INTRINSIC
low complexity region 875 941 N/A INTRINSIC
low complexity region 946 1023 N/A INTRINSIC
low complexity region 1027 1061 N/A INTRINSIC
low complexity region 1084 1112 N/A INTRINSIC
low complexity region 1117 1194 N/A INTRINSIC
low complexity region 1197 1219 N/A INTRINSIC
low complexity region 1223 1289 N/A INTRINSIC
low complexity region 1294 1371 N/A INTRINSIC
low complexity region 1375 1409 N/A INTRINSIC
low complexity region 1419 1460 N/A INTRINSIC
low complexity region 1465 1542 N/A INTRINSIC
low complexity region 1545 1567 N/A INTRINSIC
low complexity region 1571 1637 N/A INTRINSIC
low complexity region 1642 1719 N/A INTRINSIC
low complexity region 1723 1757 N/A INTRINSIC
low complexity region 1767 1808 N/A INTRINSIC
low complexity region 1813 1890 N/A INTRINSIC
low complexity region 1893 1915 N/A INTRINSIC
low complexity region 1919 1985 N/A INTRINSIC
low complexity region 1990 2067 N/A INTRINSIC
low complexity region 2071 2105 N/A INTRINSIC
low complexity region 2115 2156 N/A INTRINSIC
low complexity region 2161 2238 N/A INTRINSIC
low complexity region 2242 2276 N/A INTRINSIC
low complexity region 2286 2327 N/A INTRINSIC
low complexity region 2332 2409 N/A INTRINSIC
low complexity region 2412 2434 N/A INTRINSIC
low complexity region 2438 2504 N/A INTRINSIC
low complexity region 2509 2586 N/A INTRINSIC
low complexity region 2590 2624 N/A INTRINSIC
low complexity region 2634 2675 N/A INTRINSIC
low complexity region 2680 2757 N/A INTRINSIC
low complexity region 2760 2782 N/A INTRINSIC
low complexity region 2786 2852 N/A INTRINSIC
low complexity region 2857 2934 N/A INTRINSIC
low complexity region 2938 2972 N/A INTRINSIC
low complexity region 2982 3023 N/A INTRINSIC
low complexity region 3028 3073 N/A INTRINSIC
internal_repeat_4 3074 3145 2.96e-13 PROSPERO
internal_repeat_3 3078 3132 5.83e-17 PROSPERO
internal_repeat_2 3097 3144 3.49e-19 PROSPERO
low complexity region 3146 3162 N/A INTRINSIC
low complexity region 3193 3211 N/A INTRINSIC
internal_repeat_1 3216 3278 2.93e-23 PROSPERO
internal_repeat_4 3222 3280 2.96e-13 PROSPERO
low complexity region 3317 3330 N/A INTRINSIC
low complexity region 3340 3351 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,178 H372L Het
4931423N10Rik A G 2: 23,240,922 probably null Het
Abcb1a A T 5: 8,674,833 T89S probably benign Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Capn9 A T 8: 124,607,953 probably null Het
Cox4i1 T A 8: 120,674,040 M148K probably damaging Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dnajc3 G T 14: 118,970,780 E276* probably null Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hinfp C T 9: 44,298,989 R183Q probably damaging Het
Hpd T C 5: 123,176,189 Y221C probably benign Het
Il6st T A 13: 112,494,560 probably null Het
Impa1 T C 3: 10,322,928 K145E probably benign Het
Itga9 A T 9: 118,850,801 M847L probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Lrrfip1 T A 1: 91,115,908 H678Q probably benign Het
Mettl16 A G 11: 74,805,265 T311A probably benign Het
Nefl T C 14: 68,086,031 Y369H probably damaging Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Ramp2 T A 11: 101,247,936 L147Q probably damaging Het
Rassf1 C T 9: 107,557,974 R223C probably benign Het
Rcbtb2 T C 14: 73,173,865 F357L probably damaging Het
Rnf24 A G 2: 131,303,548 V114A probably benign Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tatdn2 T C 6: 113,709,521 S697P probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r237 T G 17: 21,314,247 D77E possibly damaging Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in Hrnr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Hrnr APN 3 93322897 missense unknown
IGL02326:Hrnr APN 3 93323745 missense unknown
IGL03030:Hrnr APN 3 93320601 missense possibly damaging 0.91
IGL03281:Hrnr APN 3 93322851 missense probably benign 0.04
R0140:Hrnr UTSW 3 93331493 nonsense probably null
R0709:Hrnr UTSW 3 93332508 missense unknown
R1179:Hrnr UTSW 3 93332543 missense unknown
R1528:Hrnr UTSW 3 93322794 missense possibly damaging 0.56
R1640:Hrnr UTSW 3 93332516 missense unknown
R1987:Hrnr UTSW 3 93332604 missense unknown
R1988:Hrnr UTSW 3 93332604 missense unknown
R3846:Hrnr UTSW 3 93332157 missense unknown
R3871:Hrnr UTSW 3 93331874 missense unknown
R3938:Hrnr UTSW 3 93322855 missense probably benign 0.35
R4569:Hrnr UTSW 3 93323568 missense unknown
R4690:Hrnr UTSW 3 93323652 missense unknown
R4761:Hrnr UTSW 3 93322755 missense probably damaging 0.96
R5182:Hrnr UTSW 3 93332143 missense unknown
R5292:Hrnr UTSW 3 93331892 missense unknown
R5739:Hrnr UTSW 3 93323129 missense unknown
R5845:Hrnr UTSW 3 93332637 missense unknown
R5994:Hrnr UTSW 3 93332300 missense unknown
R6169:Hrnr UTSW 3 93325755 nonsense probably null
R6216:Hrnr UTSW 3 93332162 missense unknown
R6256:Hrnr UTSW 3 93322611 missense probably damaging 1.00
R6670:Hrnr UTSW 3 93331885 missense unknown
R6790:Hrnr UTSW 3 93329075 missense unknown
R6936:Hrnr UTSW 3 93332360 missense unknown
R7049:Hrnr UTSW 3 93323154 nonsense probably null
R7358:Hrnr UTSW 3 93323141 nonsense probably null
R7383:Hrnr UTSW 3 93331791 missense unknown
R7724:Hrnr UTSW 3 93323016 missense unknown
R7762:Hrnr UTSW 3 93332199 missense unknown
R7945:Hrnr UTSW 3 93332199 missense unknown
R8115:Hrnr UTSW 3 93323732 missense unknown
R8383:Hrnr UTSW 3 93332346 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGGTCTACCTCAAGGGAATC -3'
(R):5'- TTCAGACCCAGAAGACTTGCC -3'

Sequencing Primer
(F):5'- AGGTCTACCTCAAGGGAATCTTCTG -3'
(R):5'- AGAAGACTTGCCTTGTCCG -3'
Posted On2020-06-30