Incidental Mutation 'R8086:Abcb1a'
ID629646
Institutional Source Beutler Lab
Gene Symbol Abcb1a
Ensembl Gene ENSMUSG00000040584
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 1A
SynonymsPgp, mdr-3, Pgy-3, MDR3, P-glycoprotein, Evi32, P-gp, Mdr1a, Pgy3, multiple drug resistant 1a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R8086 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location8660077-8748575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8674833 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 89 (T89S)
Ref Sequence ENSEMBL: ENSMUSP00000041204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047753]
PDB Structure
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structure of Mouse P-Glycoprotein [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein bound to QZ59-RRR [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein bound to QZ59-SSS [X-RAY DIFFRACTION]
>> 5 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000047753
AA Change: T89S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041204
Gene: ENSMUSG00000040584
AA Change: T89S

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Pfam:ABC_membrane 50 339 8.3e-97 PFAM
AAA 415 607 1.22e-20 SMART
Pfam:ABC_membrane 707 982 4.8e-79 PFAM
AAA 1058 1246 8.85e-18 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a p-glycoprotein which actively transports a variety of hydrophobic amphipathic drugs and plays a major role in the blood-brain barrier permeability of certain drugs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in increased sensitivity to various drugs, including avermectins and vinblastine. Mice with a null allele develop spontanous colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,178 H372L Het
4931423N10Rik A G 2: 23,240,922 probably null Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Capn9 A T 8: 124,607,953 probably null Het
Cox4i1 T A 8: 120,674,040 M148K probably damaging Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dnajc3 G T 14: 118,970,780 E276* probably null Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hinfp C T 9: 44,298,989 R183Q probably damaging Het
Hpd T C 5: 123,176,189 Y221C probably benign Het
Hrnr A T 3: 93,323,421 H322L unknown Het
Il6st T A 13: 112,494,560 probably null Het
Impa1 T C 3: 10,322,928 K145E probably benign Het
Itga9 A T 9: 118,850,801 M847L probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Lrrfip1 T A 1: 91,115,908 H678Q probably benign Het
Mettl16 A G 11: 74,805,265 T311A probably benign Het
Nefl T C 14: 68,086,031 Y369H probably damaging Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Ramp2 T A 11: 101,247,936 L147Q probably damaging Het
Rassf1 C T 9: 107,557,974 R223C probably benign Het
Rcbtb2 T C 14: 73,173,865 F357L probably damaging Het
Rnf24 A G 2: 131,303,548 V114A probably benign Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tatdn2 T C 6: 113,709,521 S697P probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r237 T G 17: 21,314,247 D77E possibly damaging Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in Abcb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Abcb1a APN 5 8686257 missense probably benign 0.01
IGL00898:Abcb1a APN 5 8733690 missense probably damaging 0.97
IGL01064:Abcb1a APN 5 8732388 missense possibly damaging 0.65
IGL01118:Abcb1a APN 5 8674687 missense probably damaging 1.00
IGL01150:Abcb1a APN 5 8702550 missense possibly damaging 0.90
IGL01584:Abcb1a APN 5 8698637 missense possibly damaging 0.95
IGL01654:Abcb1a APN 5 8715065 critical splice donor site probably null
IGL01820:Abcb1a APN 5 8715896 splice site probably benign
IGL02499:Abcb1a APN 5 8726807 missense possibly damaging 0.67
IGL02711:Abcb1a APN 5 8723245 splice site probably null
IGL02954:Abcb1a APN 5 8732341 missense probably benign 0.00
IGL03018:Abcb1a APN 5 8702451 missense probably damaging 0.99
IGL03119:Abcb1a APN 5 8714887 missense probably benign 0.00
IGL03292:Abcb1a APN 5 8715827 missense possibly damaging 0.93
IGL03338:Abcb1a APN 5 8694153 missense probably damaging 1.00
R0418:Abcb1a UTSW 5 8713281 missense probably damaging 0.96
R0559:Abcb1a UTSW 5 8698535 missense probably benign 0.01
R0595:Abcb1a UTSW 5 8740417 missense probably damaging 1.00
R0599:Abcb1a UTSW 5 8698539 missense probably benign 0.13
R0811:Abcb1a UTSW 5 8713229 missense probably damaging 1.00
R0812:Abcb1a UTSW 5 8713229 missense probably damaging 1.00
R0894:Abcb1a UTSW 5 8674856 splice site probably benign
R0948:Abcb1a UTSW 5 8740621 splice site probably null
R1292:Abcb1a UTSW 5 8713343 missense probably benign 0.00
R1318:Abcb1a UTSW 5 8701621 missense probably benign 0.31
R1459:Abcb1a UTSW 5 8702920 missense probably damaging 1.00
R1489:Abcb1a UTSW 5 8686300 critical splice donor site probably null
R1514:Abcb1a UTSW 5 8674791 missense possibly damaging 0.88
R2100:Abcb1a UTSW 5 8713202 missense probably damaging 1.00
R2409:Abcb1a UTSW 5 8738747 missense probably benign 0.30
R2844:Abcb1a UTSW 5 8686164 missense probably benign 0.02
R3709:Abcb1a UTSW 5 8738738 missense probably benign 0.03
R3755:Abcb1a UTSW 5 8747403 missense possibly damaging 0.95
R4193:Abcb1a UTSW 5 8715068 splice site probably null
R4401:Abcb1a UTSW 5 8702390 missense possibly damaging 0.54
R4463:Abcb1a UTSW 5 8719981 splice site probably benign
R4539:Abcb1a UTSW 5 8715793 missense probably benign
R4635:Abcb1a UTSW 5 8714927 missense probably benign
R4740:Abcb1a UTSW 5 8702280 critical splice donor site probably null
R4757:Abcb1a UTSW 5 8737632 missense probably damaging 0.99
R4764:Abcb1a UTSW 5 8715732 splice site probably null
R4792:Abcb1a UTSW 5 8746657 critical splice donor site probably null
R4829:Abcb1a UTSW 5 8723214 missense probably damaging 1.00
R4935:Abcb1a UTSW 5 8737773 critical splice donor site probably null
R5140:Abcb1a UTSW 5 8702154 missense probably damaging 0.99
R5181:Abcb1a UTSW 5 8714937 missense probably benign
R5355:Abcb1a UTSW 5 8726873 missense probably damaging 1.00
R5406:Abcb1a UTSW 5 8702946 missense probably damaging 0.99
R5496:Abcb1a UTSW 5 8674818 missense probably benign
R5557:Abcb1a UTSW 5 8714949 missense probably benign 0.01
R5572:Abcb1a UTSW 5 8715108 splice site probably null
R5702:Abcb1a UTSW 5 8737752 missense probably benign 0.15
R5753:Abcb1a UTSW 5 8723160 missense probably damaging 0.98
R5769:Abcb1a UTSW 5 8683426 missense probably benign 0.01
R5895:Abcb1a UTSW 5 8702216 missense probably damaging 1.00
R6536:Abcb1a UTSW 5 8719030 missense probably benign 0.01
R6555:Abcb1a UTSW 5 8702468 missense probably damaging 0.97
R6798:Abcb1a UTSW 5 8732364 missense probably damaging 1.00
R6875:Abcb1a UTSW 5 8701628 missense probably benign 0.28
R7000:Abcb1a UTSW 5 8702823 missense probably benign 0.19
R7102:Abcb1a UTSW 5 8694072 missense probably benign 0.01
R7172:Abcb1a UTSW 5 8702399 missense probably benign 0.00
R7313:Abcb1a UTSW 5 8723187 missense probably damaging 1.00
R7513:Abcb1a UTSW 5 8715771 nonsense probably null
R7718:Abcb1a UTSW 5 8715788 missense probably damaging 1.00
R7816:Abcb1a UTSW 5 8686132 missense possibly damaging 0.56
R7829:Abcb1a UTSW 5 8698623 missense probably benign 0.06
R7943:Abcb1a UTSW 5 8686222 missense probably benign
R8040:Abcb1a UTSW 5 8715035 missense probably benign 0.00
R8271:Abcb1a UTSW 5 8686212 missense probably benign 0.41
R8367:Abcb1a UTSW 5 8686221 missense probably benign 0.00
Z1177:Abcb1a UTSW 5 8746544 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTTTGGGTGTAGAGGAAAACATC -3'
(R):5'- TGGGCTAATGCTTGTATCAGC -3'

Sequencing Primer
(F):5'- CCATGAAACTATCTGATGTCCATGG -3'
(R):5'- GCTTCTCAAGTTCACTACAAGGGTG -3'
Posted On2020-06-30