Incidental Mutation 'R8086:Hpd'
ID629648
Institutional Source Beutler Lab
Gene Symbol Hpd
Ensembl Gene ENSMUSG00000029445
Gene Name4-hydroxyphenylpyruvic acid dioxygenase
SynonymsLaf, Flp, Fla, Hppd
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R8086 (G1)
Quality Score218.009
Status Validated
Chromosome5
Chromosomal Location123171807-123182727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123176189 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 221 (Y221C)
Ref Sequence ENSEMBL: ENSMUSP00000031398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031398] [ENSMUST00000154713]
Predicted Effect probably benign
Transcript: ENSMUST00000031398
AA Change: Y221C

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031398
Gene: ENSMUSG00000029445
AA Change: Y221C

DomainStartEndE-ValueType
Pfam:Glyoxalase 18 138 5.6e-10 PFAM
Pfam:Glyoxalase_4 20 134 7.7e-10 PFAM
Pfam:Glyoxalase_2 24 147 4.5e-9 PFAM
Pfam:Glyoxalase 180 335 2.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144679
SMART Domains Protein: ENSMUSP00000118702
Gene: ENSMUSG00000029445

DomainStartEndE-ValueType
PDB:1SQI|B 2 89 4e-51 PDB
SCOP:d1cjxa2 3 89 3e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154713
SMART Domains Protein: ENSMUSP00000121922
Gene: ENSMUSG00000029445

DomainStartEndE-ValueType
SCOP:d1cjxa1 1 122 3e-13 SMART
PDB:1SQI|B 1 159 1e-113 PDB
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme in the catabolic pathway of tyrosine. The encoded protein catalyzes the conversion of 4-hydroxyphenylpyruvate to homogentisate. Defects in this gene are a cause of tyrosinemia type 3 (TYRO3) and hawkinsinuria (HAWK). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
PHENOTYPE: CBA, C3H, DBA/2, SM and AKR have the F.1 form of this soluble liver antigen; A/J, A2G, BALB/c and C57BL/10 the F.2 form. F.2 antigen induces precipitating antibodies in F.1 but not F.2 strains and vice versa. F antigen immune response requires H2 Kk or Ak alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,178 H372L Het
4931423N10Rik A G 2: 23,240,922 probably null Het
Abcb1a A T 5: 8,674,833 T89S probably benign Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Capn9 A T 8: 124,607,953 probably null Het
Cox4i1 T A 8: 120,674,040 M148K probably damaging Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dnajc3 G T 14: 118,970,780 E276* probably null Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hinfp C T 9: 44,298,989 R183Q probably damaging Het
Hrnr A T 3: 93,323,421 H322L unknown Het
Il6st T A 13: 112,494,560 probably null Het
Impa1 T C 3: 10,322,928 K145E probably benign Het
Itga9 A T 9: 118,850,801 M847L probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Lrrfip1 T A 1: 91,115,908 H678Q probably benign Het
Mettl16 A G 11: 74,805,265 T311A probably benign Het
Nefl T C 14: 68,086,031 Y369H probably damaging Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Ramp2 T A 11: 101,247,936 L147Q probably damaging Het
Rassf1 C T 9: 107,557,974 R223C probably benign Het
Rcbtb2 T C 14: 73,173,865 F357L probably damaging Het
Rnf24 A G 2: 131,303,548 V114A probably benign Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tatdn2 T C 6: 113,709,521 S697P probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r237 T G 17: 21,314,247 D77E possibly damaging Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in Hpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02483:Hpd APN 5 123182578 splice site probably null
IGL02510:Hpd APN 5 123181910 missense possibly damaging 0.95
IGL02574:Hpd APN 5 123179357 splice site probably benign
IGL02642:Hpd APN 5 123181440 missense possibly damaging 0.86
IGL03374:Hpd APN 5 123172045 missense probably damaging 1.00
pyruvian UTSW 5 123178192 nonsense probably null
R0079:Hpd UTSW 5 123181481 missense probably damaging 1.00
R1022:Hpd UTSW 5 123174469 missense possibly damaging 0.94
R1024:Hpd UTSW 5 123174469 missense possibly damaging 0.94
R1165:Hpd UTSW 5 123176090 critical splice donor site probably null
R2414:Hpd UTSW 5 123177524 unclassified probably null
R6572:Hpd UTSW 5 123180676 missense probably benign 0.22
R6604:Hpd UTSW 5 123180901 unclassified probably null
R6616:Hpd UTSW 5 123172060 missense probably damaging 1.00
R7539:Hpd UTSW 5 123178192 nonsense probably null
R7952:Hpd UTSW 5 123178264 missense possibly damaging 0.91
R8023:Hpd UTSW 5 123176234 missense probably damaging 1.00
R8134:Hpd UTSW 5 123174380 missense probably benign
X0023:Hpd UTSW 5 123174439 missense probably damaging 1.00
Z1176:Hpd UTSW 5 123181475 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTCCACATATTCCTGGGAGG -3'
(R):5'- TGAGGATCCTGTGTAACGGG -3'

Sequencing Primer
(F):5'- GGAGACCACTATCATTTATCCATCTG -3'
(R):5'- AACGGGTGTATGCTCAATGG -3'
Posted On2020-06-30