Incidental Mutation 'R8086:Tatdn2'
ID629651
Institutional Source Beutler Lab
Gene Symbol Tatdn2
Ensembl Gene ENSMUSG00000056952
Gene NameTatD DNase domain containing 2
SynonymsmKIAA0218
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8086 (G1)
Quality Score199.009
Status Validated
Chromosome6
Chromosomal Location113697050-113711069 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113709521 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 697 (S697P)
Ref Sequence ENSEMBL: ENSMUSP00000108645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089018] [ENSMUST00000113022] [ENSMUST00000153661] [ENSMUST00000204753]
Predicted Effect probably damaging
Transcript: ENSMUST00000089018
AA Change: S636P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086412
Gene: ENSMUSG00000056952
AA Change: S636P

DomainStartEndE-ValueType
low complexity region 63 95 N/A INTRINSIC
low complexity region 237 255 N/A INTRINSIC
low complexity region 382 392 N/A INTRINSIC
Pfam:TatD_DNase 457 721 3.3e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113022
AA Change: S697P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108645
Gene: ENSMUSG00000056952
AA Change: S697P

DomainStartEndE-ValueType
low complexity region 63 95 N/A INTRINSIC
low complexity region 237 255 N/A INTRINSIC
low complexity region 443 453 N/A INTRINSIC
Pfam:TatD_DNase 518 782 3.7e-61 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000116559
Gene: ENSMUSG00000056952
AA Change: S60P

DomainStartEndE-ValueType
Pfam:TatD_DNase 1 146 2.9e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153661
SMART Domains Protein: ENSMUSP00000123557
Gene: ENSMUSG00000056952

DomainStartEndE-ValueType
Pfam:TatD_DNase 1 122 1.3e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204753
AA Change: S697P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145308
Gene: ENSMUSG00000056952
AA Change: S697P

DomainStartEndE-ValueType
low complexity region 63 95 N/A INTRINSIC
low complexity region 237 255 N/A INTRINSIC
low complexity region 443 453 N/A INTRINSIC
Pfam:TatD_DNase 518 782 3.7e-61 PFAM
Meta Mutation Damage Score 0.4376 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,178 H372L Het
4931423N10Rik A G 2: 23,240,922 probably null Het
Abcb1a A T 5: 8,674,833 T89S probably benign Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Capn9 A T 8: 124,607,953 probably null Het
Cox4i1 T A 8: 120,674,040 M148K probably damaging Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dnajc3 G T 14: 118,970,780 E276* probably null Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hinfp C T 9: 44,298,989 R183Q probably damaging Het
Hpd T C 5: 123,176,189 Y221C probably benign Het
Hrnr A T 3: 93,323,421 H322L unknown Het
Il6st T A 13: 112,494,560 probably null Het
Impa1 T C 3: 10,322,928 K145E probably benign Het
Itga9 A T 9: 118,850,801 M847L probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Lrrfip1 T A 1: 91,115,908 H678Q probably benign Het
Mettl16 A G 11: 74,805,265 T311A probably benign Het
Nefl T C 14: 68,086,031 Y369H probably damaging Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Ramp2 T A 11: 101,247,936 L147Q probably damaging Het
Rassf1 C T 9: 107,557,974 R223C probably benign Het
Rcbtb2 T C 14: 73,173,865 F357L probably damaging Het
Rnf24 A G 2: 131,303,548 V114A probably benign Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r237 T G 17: 21,314,247 D77E possibly damaging Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in Tatdn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Tatdn2 APN 6 113704024 splice site probably benign
IGL01335:Tatdn2 APN 6 113704056 missense probably benign 0.29
IGL01459:Tatdn2 APN 6 113710031 splice site probably null
IGL02406:Tatdn2 APN 6 113704213 missense probably benign 0.41
IGL02728:Tatdn2 APN 6 113704715 missense probably damaging 1.00
R0321:Tatdn2 UTSW 6 113709501 missense probably damaging 1.00
R0506:Tatdn2 UTSW 6 113702589 missense probably benign 0.13
R0583:Tatdn2 UTSW 6 113702525 missense possibly damaging 0.80
R1022:Tatdn2 UTSW 6 113709545 missense probably damaging 1.00
R1024:Tatdn2 UTSW 6 113709545 missense probably damaging 1.00
R1301:Tatdn2 UTSW 6 113704115 missense probably damaging 1.00
R1454:Tatdn2 UTSW 6 113704327 missense probably benign 0.26
R1459:Tatdn2 UTSW 6 113710070 missense probably damaging 1.00
R1710:Tatdn2 UTSW 6 113697927 missense possibly damaging 0.90
R1771:Tatdn2 UTSW 6 113702099 critical splice acceptor site probably null
R2064:Tatdn2 UTSW 6 113704142 missense probably benign 0.41
R2065:Tatdn2 UTSW 6 113704142 missense probably benign 0.41
R2067:Tatdn2 UTSW 6 113704142 missense probably benign 0.41
R4446:Tatdn2 UTSW 6 113702540 critical splice donor site probably null
R4654:Tatdn2 UTSW 6 113707365 missense probably benign 0.09
R4888:Tatdn2 UTSW 6 113704605 missense possibly damaging 0.66
R7378:Tatdn2 UTSW 6 113704701 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCTTGCTCTGGAGTCTG -3'
(R):5'- TATATCGCACAAGGTGGACCAG -3'

Sequencing Primer
(F):5'- AGTCTGCTTGGATGCAAATTTTTC -3'
(R):5'- ACCAGGAGGACACTGGGACTC -3'
Posted On2020-06-30