Incidental Mutation 'R8086:Cox4i1'
ID629657
Institutional Source Beutler Lab
Gene Symbol Cox4i1
Ensembl Gene ENSMUSG00000031818
Gene Namecytochrome c oxidase subunit 4I1
SynonymsCox4, Cox4a, COXIV
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8086 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location120668222-120674207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120674040 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 148 (M148K)
Ref Sequence ENSEMBL: ENSMUSP00000034276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034276] [ENSMUST00000127664] [ENSMUST00000181586] [ENSMUST00000181795] [ENSMUST00000181847]
Predicted Effect probably damaging
Transcript: ENSMUST00000034276
AA Change: M148K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034276
Gene: ENSMUSG00000031818
AA Change: M148K

DomainStartEndE-ValueType
Pfam:COX4 28 168 2.5e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000181586
AA Change: M148K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138019
Gene: ENSMUSG00000031818
AA Change: M148K

DomainStartEndE-ValueType
Pfam:COX4 26 168 3.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181795
SMART Domains Protein: ENSMUSP00000138063
Gene: ENSMUSG00000031818

DomainStartEndE-ValueType
Pfam:COX4 2 92 4.5e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181847
SMART Domains Protein: ENSMUSP00000138053
Gene: ENSMUSG00000031818

DomainStartEndE-ValueType
PDB:2Y69|Q 1 35 4e-7 PDB
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytochrome c oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme complex that couples the transfer of electrons from cytochrome c to molecular oxygen and contributes to a proton electrochemical gradient across the inner mitochondrial membrane. The complex consists of 13 mitochondrial- and nuclear-encoded subunits. The mitochondrially-encoded subunits perform the electron transfer and proton pumping activities. The functions of the nuclear-encoded subunits are unknown but they may play a role in the regulation and assembly of the complex. This gene encodes the nuclear-encoded subunit IV isoform 1 of the human mitochondrial respiratory chain enzyme. It is located at the 3' of the NOC4 (neighbor of COX4) gene in a head-to-head orientation, and shares a promoter with it. Pseudogenes related to this gene are located on chromosomes 13 and 14. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,178 H372L Het
4931423N10Rik A G 2: 23,240,922 probably null Het
Abcb1a A T 5: 8,674,833 T89S probably benign Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Capn9 A T 8: 124,607,953 probably null Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dnajc3 G T 14: 118,970,780 E276* probably null Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hinfp C T 9: 44,298,989 R183Q probably damaging Het
Hpd T C 5: 123,176,189 Y221C probably benign Het
Hrnr A T 3: 93,323,421 H322L unknown Het
Il6st T A 13: 112,494,560 probably null Het
Impa1 T C 3: 10,322,928 K145E probably benign Het
Itga9 A T 9: 118,850,801 M847L probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Lrrfip1 T A 1: 91,115,908 H678Q probably benign Het
Mettl16 A G 11: 74,805,265 T311A probably benign Het
Nefl T C 14: 68,086,031 Y369H probably damaging Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Ramp2 T A 11: 101,247,936 L147Q probably damaging Het
Rassf1 C T 9: 107,557,974 R223C probably benign Het
Rcbtb2 T C 14: 73,173,865 F357L probably damaging Het
Rnf24 A G 2: 131,303,548 V114A probably benign Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tatdn2 T C 6: 113,709,521 S697P probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r237 T G 17: 21,314,247 D77E possibly damaging Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in Cox4i1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Cox4i1 APN 8 120672865 missense probably benign 0.15
R1174:Cox4i1 UTSW 8 120674050 missense probably benign 0.41
R1276:Cox4i1 UTSW 8 120673350 missense probably damaging 1.00
R2507:Cox4i1 UTSW 8 120673290 missense possibly damaging 0.95
R2508:Cox4i1 UTSW 8 120673290 missense possibly damaging 0.95
R2698:Cox4i1 UTSW 8 120669363 unclassified probably benign
R6523:Cox4i1 UTSW 8 120672741 missense probably benign 0.13
R6747:Cox4i1 UTSW 8 120673230 missense possibly damaging 0.95
R7429:Cox4i1 UTSW 8 120674031 missense probably damaging 1.00
R7430:Cox4i1 UTSW 8 120674031 missense probably damaging 1.00
R7750:Cox4i1 UTSW 8 120673310 missense probably benign 0.01
Z1177:Cox4i1 UTSW 8 120668280 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCTTTCACAATCGAGGGAGG -3'
(R):5'- CCTTCATCTAGTGACTGCCAAAG -3'

Sequencing Primer
(F):5'- TCACAATCGAGGGAGGTTCTG -3'
(R):5'- TCTAGTGACTGCCAAAGAATGAAC -3'
Posted On2020-06-30