Incidental Mutation 'R8086:Capn9'
ID629658
Institutional Source Beutler Lab
Gene Symbol Capn9
Ensembl Gene ENSMUSG00000031981
Gene Namecalpain 9
SynonymsGC36, nCL-4
MMRRC Submission
Accession Numbers

Genbank: NM_023709; MGI: 1920897

Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R8086 (G1)
Quality Score88.0076
Status Validated
Chromosome8
Chromosomal Location124576111-124618731 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 124607953 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093033]
Predicted Effect probably null
Transcript: ENSMUST00000093033
SMART Domains Protein: ENSMUSP00000090717
Gene: ENSMUSG00000031981

DomainStartEndE-ValueType
CysPc 24 345 1.53e-196 SMART
calpain_III 348 494 1.91e-87 SMART
low complexity region 504 522 N/A INTRINSIC
EFh 565 593 1.25e-2 SMART
EFh 595 623 2.64e-1 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The protein encoded by this gene is expressed predominantly in stomach and small intestine and may have specialized functions in the digestive tract. This gene is thought to be associated with gastric cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to ethanol-induced gastric mucosa injury. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,178 H372L Het
4931423N10Rik A G 2: 23,240,922 probably null Het
Abcb1a A T 5: 8,674,833 T89S probably benign Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Cox4i1 T A 8: 120,674,040 M148K probably damaging Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dnajc3 G T 14: 118,970,780 E276* probably null Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hinfp C T 9: 44,298,989 R183Q probably damaging Het
Hpd T C 5: 123,176,189 Y221C probably benign Het
Hrnr A T 3: 93,323,421 H322L unknown Het
Il6st T A 13: 112,494,560 probably null Het
Impa1 T C 3: 10,322,928 K145E probably benign Het
Itga9 A T 9: 118,850,801 M847L probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Lrrfip1 T A 1: 91,115,908 H678Q probably benign Het
Mettl16 A G 11: 74,805,265 T311A probably benign Het
Nefl T C 14: 68,086,031 Y369H probably damaging Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Ramp2 T A 11: 101,247,936 L147Q probably damaging Het
Rassf1 C T 9: 107,557,974 R223C probably benign Het
Rcbtb2 T C 14: 73,173,865 F357L probably damaging Het
Rnf24 A G 2: 131,303,548 V114A probably benign Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tatdn2 T C 6: 113,709,521 S697P probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r237 T G 17: 21,314,247 D77E possibly damaging Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in Capn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Capn9 APN 8 124591769 missense probably benign
IGL01987:Capn9 APN 8 124576226 missense probably benign 0.01
IGL02150:Capn9 APN 8 124613843 missense probably benign 0.01
IGL02348:Capn9 APN 8 124594677 missense probably damaging 1.00
IGL02720:Capn9 APN 8 124600497 splice site probably benign
IGL02723:Capn9 APN 8 124609183 splice site probably benign
IGL03065:Capn9 APN 8 124605559 missense probably damaging 1.00
IGL03169:Capn9 APN 8 124605877 missense probably damaging 1.00
A2778:Capn9 UTSW 8 124605478 missense possibly damaging 0.95
R0288:Capn9 UTSW 8 124600491 splice site probably benign
R1353:Capn9 UTSW 8 124605566 splice site probably null
R1611:Capn9 UTSW 8 124611512 missense possibly damaging 0.90
R1672:Capn9 UTSW 8 124613831 missense probably benign 0.03
R1682:Capn9 UTSW 8 124611565 splice site probably null
R1729:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1739:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1762:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1783:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1784:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1785:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1836:Capn9 UTSW 8 124605565 critical splice donor site probably null
R1883:Capn9 UTSW 8 124611558 missense probably benign
R1924:Capn9 UTSW 8 124576226 missense probably benign 0.01
R2008:Capn9 UTSW 8 124591685 missense probably damaging 1.00
R2049:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2069:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2131:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2141:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2219:Capn9 UTSW 8 124609159 nonsense probably null
R4193:Capn9 UTSW 8 124600486 missense probably null 0.00
R4707:Capn9 UTSW 8 124613456 missense possibly damaging 0.82
R5092:Capn9 UTSW 8 124597525 missense probably damaging 1.00
R5386:Capn9 UTSW 8 124605540 missense possibly damaging 0.83
R5697:Capn9 UTSW 8 124589071 missense unknown
R5734:Capn9 UTSW 8 124605844 missense probably damaging 1.00
R5999:Capn9 UTSW 8 124589078 missense probably damaging 1.00
R6026:Capn9 UTSW 8 124605862 missense probably damaging 1.00
R6298:Capn9 UTSW 8 124617454 missense probably benign
R6787:Capn9 UTSW 8 124616185 missense probably benign 0.00
R6856:Capn9 UTSW 8 124597569 missense probably damaging 1.00
R7131:Capn9 UTSW 8 124576278 missense probably damaging 1.00
R7149:Capn9 UTSW 8 124605709 missense probably benign 0.00
R7975:Capn9 UTSW 8 124598776 missense probably damaging 1.00
RF015:Capn9 UTSW 8 124618482 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCACACTGGACAGGTTTG -3'
(R):5'- GAGCTGTCTTCTCCTGAATTTG -3'

Sequencing Primer
(F):5'- CACACTGGACAGGTTTGAAAGGC -3'
(R):5'- CTGCAGATCAGGCTAGCTTTGAAC -3'
Posted On2020-06-30