Incidental Mutation 'R8086:Hinfp'
ID629659
Institutional Source Beutler Lab
Gene Symbol Hinfp
Ensembl Gene ENSMUSG00000032119
Gene Namehistone H4 transcription factor
SynonymsMizf, DKFZp434F162
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8086 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location44292440-44305671 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44298989 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 183 (R183Q)
Ref Sequence ENSEMBL: ENSMUSP00000149879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034629] [ENSMUST00000214660] [ENSMUST00000216508]
Predicted Effect probably damaging
Transcript: ENSMUST00000034629
AA Change: R183Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034629
Gene: ENSMUSG00000032119
AA Change: R183Q

DomainStartEndE-ValueType
ZnF_C2H2 15 39 8.09e-1 SMART
low complexity region 49 59 N/A INTRINSIC
ZnF_C2H2 60 85 2.82e1 SMART
ZnF_C2H2 125 149 1.16e1 SMART
ZnF_C2H2 165 189 5.42e-2 SMART
ZnF_C2H2 195 215 9.81e1 SMART
ZnF_C2H2 225 247 3.69e-4 SMART
ZnF_C2H2 251 274 1.4e-4 SMART
ZnF_C2H2 280 302 1.67e-2 SMART
ZnF_C2H2 308 333 5.06e-2 SMART
ZnF_C2H2 341 364 2.75e-3 SMART
low complexity region 399 406 N/A INTRINSIC
low complexity region 425 448 N/A INTRINSIC
low complexity region 482 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214660
Predicted Effect probably damaging
Transcript: ENSMUST00000216508
AA Change: R183Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that interacts with methyl-CpG-binding protein-2 (MBD2), a component of the MeCP1 histone deacetylase (HDAC) complex, and plays a role in DNA methylation and transcription repression. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality associated with delayed hatching and failure of the blastocyst to expand. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,178 H372L Het
4931423N10Rik A G 2: 23,240,922 probably null Het
Abcb1a A T 5: 8,674,833 T89S probably benign Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Capn9 A T 8: 124,607,953 probably null Het
Cox4i1 T A 8: 120,674,040 M148K probably damaging Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dnajc3 G T 14: 118,970,780 E276* probably null Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hpd T C 5: 123,176,189 Y221C probably benign Het
Hrnr A T 3: 93,323,421 H322L unknown Het
Il6st T A 13: 112,494,560 probably null Het
Impa1 T C 3: 10,322,928 K145E probably benign Het
Itga9 A T 9: 118,850,801 M847L probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Lrrfip1 T A 1: 91,115,908 H678Q probably benign Het
Mettl16 A G 11: 74,805,265 T311A probably benign Het
Nefl T C 14: 68,086,031 Y369H probably damaging Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Ramp2 T A 11: 101,247,936 L147Q probably damaging Het
Rassf1 C T 9: 107,557,974 R223C probably benign Het
Rcbtb2 T C 14: 73,173,865 F357L probably damaging Het
Rnf24 A G 2: 131,303,548 V114A probably benign Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tatdn2 T C 6: 113,709,521 S697P probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r237 T G 17: 21,314,247 D77E possibly damaging Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in Hinfp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Hinfp APN 9 44297766 missense probably damaging 1.00
IGL00973:Hinfp APN 9 44298139 missense probably benign 0.43
R0131:Hinfp UTSW 9 44299763 missense probably damaging 1.00
R0131:Hinfp UTSW 9 44299763 missense probably damaging 1.00
R0132:Hinfp UTSW 9 44299763 missense probably damaging 1.00
R0207:Hinfp UTSW 9 44296327 missense possibly damaging 0.84
R0254:Hinfp UTSW 9 44298239 missense probably damaging 1.00
R0390:Hinfp UTSW 9 44298948 missense probably damaging 1.00
R2116:Hinfp UTSW 9 44299615 missense probably damaging 1.00
R3613:Hinfp UTSW 9 44297744 missense probably damaging 1.00
R3742:Hinfp UTSW 9 44302515 missense probably damaging 1.00
R5199:Hinfp UTSW 9 44296392 missense probably benign 0.00
R5773:Hinfp UTSW 9 44299236 missense probably benign 0.09
R5788:Hinfp UTSW 9 44297808 missense possibly damaging 0.89
R6210:Hinfp UTSW 9 44298872 critical splice donor site probably null
R6968:Hinfp UTSW 9 44297985 missense probably benign 0.00
R7294:Hinfp UTSW 9 44299270 missense probably damaging 0.97
R7402:Hinfp UTSW 9 44298017 missense probably damaging 1.00
R7693:Hinfp UTSW 9 44298345 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGAAGTGCCTGATCCCAAAG -3'
(R):5'- CCCTGGAGGTGTAAAGGTCTAG -3'

Sequencing Primer
(F):5'- TGCAGGGCACAGATCTCAG -3'
(R):5'- GTGTAAAGGTCTAGAGGAGCC -3'
Posted On2020-06-30