Incidental Mutation 'R8086:Rassf1'
ID629661
Institutional Source Beutler Lab
Gene Symbol Rassf1
Ensembl Gene ENSMUSG00000010067
Gene NameRas association (RalGDS/AF-6) domain family member 1
Synonyms123F protein, NORE2A, Rassf1A, Rassf1B, Rassf1C, RDA32, REH3P21
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R8086 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location107551555-107562267 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107557974 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 223 (R223C)
Ref Sequence ENSEMBL: ENSMUSP00000091301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010211] [ENSMUST00000093786] [ENSMUST00000122225] [ENSMUST00000156198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010211
AA Change: R153C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000010211
Gene: ENSMUSG00000010067
AA Change: R153C

DomainStartEndE-ValueType
low complexity region 98 115 N/A INTRINSIC
RA 124 218 6.26e-24 SMART
PDB:4LGD|H 219 264 3e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000093786
AA Change: R223C

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000091301
Gene: ENSMUSG00000010067
AA Change: R223C

DomainStartEndE-ValueType
C1 44 101 4.7e-7 SMART
low complexity region 168 185 N/A INTRINSIC
RA 194 288 6.26e-24 SMART
PDB:4LGD|H 289 334 3e-12 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000122225
AA Change: R227C

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113252
Gene: ENSMUSG00000010067
AA Change: R227C

DomainStartEndE-ValueType
C1 44 105 1.92e-3 SMART
low complexity region 172 189 N/A INTRINSIC
RA 198 292 6.26e-24 SMART
Pfam:Nore1-SARAH 299 338 4.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156198
SMART Domains Protein: ENSMUSP00000117722
Gene: ENSMUSG00000010067

DomainStartEndE-ValueType
Blast:C1 44 83 6e-24 BLAST
SCOP:d1ptq__ 52 82 5e-10 SMART
Meta Mutation Damage Score 0.1952 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to the RAS effector proteins. Loss or altered expression of this gene has been associated with the pathogenesis of a variety of cancers, which suggests the tumor suppressor function of this gene. The inactivation of this gene was found to be correlated with the hypermethylation of its CpG-island promoter region. The encoded protein was found to interact with DNA repair protein XPA. The protein was also shown to inhibit the accumulation of cyclin D1, and thus induce cell cycle arrest. Several alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous and heterozygous null mice display increased tumor incidence, especially of lung adenomas and lymphomas, and increased sensitivity to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,178 H372L Het
4931423N10Rik A G 2: 23,240,922 probably null Het
Abcb1a A T 5: 8,674,833 T89S probably benign Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Capn9 A T 8: 124,607,953 probably null Het
Cox4i1 T A 8: 120,674,040 M148K probably damaging Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dnajc3 G T 14: 118,970,780 E276* probably null Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hinfp C T 9: 44,298,989 R183Q probably damaging Het
Hpd T C 5: 123,176,189 Y221C probably benign Het
Hrnr A T 3: 93,323,421 H322L unknown Het
Il6st T A 13: 112,494,560 probably null Het
Impa1 T C 3: 10,322,928 K145E probably benign Het
Itga9 A T 9: 118,850,801 M847L probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Lrrfip1 T A 1: 91,115,908 H678Q probably benign Het
Mettl16 A G 11: 74,805,265 T311A probably benign Het
Nefl T C 14: 68,086,031 Y369H probably damaging Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Ramp2 T A 11: 101,247,936 L147Q probably damaging Het
Rcbtb2 T C 14: 73,173,865 F357L probably damaging Het
Rnf24 A G 2: 131,303,548 V114A probably benign Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tatdn2 T C 6: 113,709,521 S697P probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r237 T G 17: 21,314,247 D77E possibly damaging Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in Rassf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Rassf1 APN 9 107558311 splice site probably benign
R0570:Rassf1 UTSW 9 107557966 missense probably damaging 1.00
R1548:Rassf1 UTSW 9 107551846 missense probably benign 0.00
R1826:Rassf1 UTSW 9 107558193 missense probably damaging 0.99
R2312:Rassf1 UTSW 9 107557550 missense probably damaging 1.00
R2899:Rassf1 UTSW 9 107554194 missense probably null 0.00
R3902:Rassf1 UTSW 9 107554840 missense probably damaging 1.00
R4705:Rassf1 UTSW 9 107557867 missense probably benign 0.04
R5491:Rassf1 UTSW 9 107561415 missense possibly damaging 0.95
R5733:Rassf1 UTSW 9 107558014 missense probably damaging 1.00
R5863:Rassf1 UTSW 9 107557824 missense probably damaging 1.00
R5986:Rassf1 UTSW 9 107551822 missense possibly damaging 0.51
R7571:Rassf1 UTSW 9 107551783 missense possibly damaging 0.70
R7841:Rassf1 UTSW 9 107561545 makesense probably null
Predicted Primers PCR Primer
(F):5'- TTCAGCTGAAACTAGTGCGTCC -3'
(R):5'- TTCAAGGGCTGCTCGTCATC -3'

Sequencing Primer
(F):5'- AAACTAGTGCGTCCTGTTTCAG -3'
(R):5'- TTAAAGACAGACTCAGGTGGCTC -3'
Posted On2020-06-30