Incidental Mutation 'R8086:Itga9'
ID629662
Institutional Source Beutler Lab
Gene Symbol Itga9
Ensembl Gene ENSMUSG00000039115
Gene Nameintegrin alpha 9
SynonymsD9Ertd428e, 2610002H11Rik, 6720458D17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8086 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location118606690-118901003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118850801 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 847 (M847L)
Ref Sequence ENSEMBL: ENSMUSP00000044227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044165] [ENSMUST00000124360]
Predicted Effect probably benign
Transcript: ENSMUST00000044165
AA Change: M847L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044227
Gene: ENSMUSG00000039115
AA Change: M847L

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 105 8.95e-7 SMART
low complexity region 181 191 N/A INTRINSIC
Int_alpha 244 297 2.12e-8 SMART
Int_alpha 301 356 1.68e-11 SMART
Int_alpha 361 416 2.9e-15 SMART
Int_alpha 423 476 1.11e-2 SMART
SCOP:d1m1xa2 626 766 3e-32 SMART
SCOP:d1m1xa3 769 970 1e-39 SMART
transmembrane domain 981 1003 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124360
AA Change: M261L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122417
Gene: ENSMUSG00000039115
AA Change: M261L

DomainStartEndE-ValueType
Pfam:Integrin_alpha2 1 357 2.1e-61 PFAM
transmembrane domain 395 417 N/A INTRINSIC
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane glycoproteins composed of an alpha chain and a beta chain that mediate cell-cell and cell-matrix adhesion. The protein encoded by this gene, when bound to the beta 1 chain, forms an integrin that is a receptor for VCAM1, cytotactin and osteopontin. Expression of this gene has been found to be upregulated in small cell lung cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in respiratory distress leading to postnatal lethality caused by an accumulation of pleural fluid rich in triglyceride, cholesterol and lymphocytes. Mice develop edema and lymphocytic infiltration in the chest wall. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,178 H372L Het
4931423N10Rik A G 2: 23,240,922 probably null Het
Abcb1a A T 5: 8,674,833 T89S probably benign Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Capn9 A T 8: 124,607,953 probably null Het
Cox4i1 T A 8: 120,674,040 M148K probably damaging Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dnajc3 G T 14: 118,970,780 E276* probably null Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hinfp C T 9: 44,298,989 R183Q probably damaging Het
Hpd T C 5: 123,176,189 Y221C probably benign Het
Hrnr A T 3: 93,323,421 H322L unknown Het
Il6st T A 13: 112,494,560 probably null Het
Impa1 T C 3: 10,322,928 K145E probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Lrrfip1 T A 1: 91,115,908 H678Q probably benign Het
Mettl16 A G 11: 74,805,265 T311A probably benign Het
Nefl T C 14: 68,086,031 Y369H probably damaging Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Ramp2 T A 11: 101,247,936 L147Q probably damaging Het
Rassf1 C T 9: 107,557,974 R223C probably benign Het
Rcbtb2 T C 14: 73,173,865 F357L probably damaging Het
Rnf24 A G 2: 131,303,548 V114A probably benign Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tatdn2 T C 6: 113,709,521 S697P probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r237 T G 17: 21,314,247 D77E possibly damaging Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in Itga9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Itga9 APN 9 118769159 start codon destroyed probably null 0.02
IGL01396:Itga9 APN 9 118607123 splice site probably benign
IGL01476:Itga9 APN 9 118607111 missense probably damaging 1.00
IGL01573:Itga9 APN 9 118877230 splice site probably benign
IGL01958:Itga9 APN 9 118636494 splice site probably benign
IGL02060:Itga9 APN 9 118661432 missense probably damaging 1.00
IGL02146:Itga9 APN 9 118834332 missense possibly damaging 0.50
IGL02391:Itga9 APN 9 118850805 missense probably benign 0.19
IGL02947:Itga9 APN 9 118658533 missense probably damaging 1.00
IGL03014:Itga9 UTSW 9 118628144 missense probably benign
R0052:Itga9 UTSW 9 118636549 missense probably damaging 1.00
R0052:Itga9 UTSW 9 118636549 missense probably damaging 1.00
R0142:Itga9 UTSW 9 118636586 missense probably damaging 0.96
R0179:Itga9 UTSW 9 118661386 missense probably benign 0.11
R0207:Itga9 UTSW 9 118769253 splice site probably benign
R0364:Itga9 UTSW 9 118841142 missense probably benign
R0458:Itga9 UTSW 9 118681028 critical splice donor site probably null
R1486:Itga9 UTSW 9 118626450 missense probably damaging 0.98
R1589:Itga9 UTSW 9 118607117 critical splice donor site probably null
R1620:Itga9 UTSW 9 118843502 missense probably benign 0.00
R1711:Itga9 UTSW 9 118698461 missense probably benign 0.00
R1721:Itga9 UTSW 9 118698306 splice site probably benign
R2064:Itga9 UTSW 9 118807293 missense probably damaging 0.99
R2201:Itga9 UTSW 9 118877115 splice site probably benign
R2851:Itga9 UTSW 9 118636536 missense probably damaging 0.98
R2853:Itga9 UTSW 9 118636536 missense probably damaging 0.98
R3962:Itga9 UTSW 9 118628186 missense possibly damaging 0.57
R4180:Itga9 UTSW 9 118607078 missense probably damaging 1.00
R4597:Itga9 UTSW 9 118843514 missense probably damaging 1.00
R4716:Itga9 UTSW 9 118681758 missense probably damaging 0.98
R4929:Itga9 UTSW 9 118807249 missense probably damaging 1.00
R5002:Itga9 UTSW 9 118663898 nonsense probably null
R5279:Itga9 UTSW 9 118628205 missense probably damaging 1.00
R5542:Itga9 UTSW 9 118843661 missense possibly damaging 0.86
R5869:Itga9 UTSW 9 118663889 missense probably damaging 1.00
R6372:Itga9 UTSW 9 118897321 missense probably damaging 1.00
R6470:Itga9 UTSW 9 118897267 missense probably damaging 0.99
R6581:Itga9 UTSW 9 118658564 missense probably benign 0.00
R6919:Itga9 UTSW 9 118887815 missense probably damaging 1.00
R7034:Itga9 UTSW 9 118698365 missense probably benign 0.00
R7036:Itga9 UTSW 9 118698365 missense probably benign 0.00
R7043:Itga9 UTSW 9 118769116 missense probably damaging 0.96
R7237:Itga9 UTSW 9 118636602 missense probably benign 0.09
R7491:Itga9 UTSW 9 118769111 missense probably damaging 0.99
R7629:Itga9 UTSW 9 118698446 missense probably benign 0.00
R7774:Itga9 UTSW 9 118871900 missense probably damaging 1.00
R7782:Itga9 UTSW 9 118843644 missense
R7789:Itga9 UTSW 9 118658496 missense possibly damaging 0.80
R7904:Itga9 UTSW 9 118877226 splice site probably null
R8158:Itga9 UTSW 9 118877143 missense probably damaging 0.99
R8204:Itga9 UTSW 9 118871921 missense probably damaging 1.00
Z1176:Itga9 UTSW 9 118843530 missense probably benign 0.00
Z1176:Itga9 UTSW 9 118887839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTCAGGGACTCTTTAGG -3'
(R):5'- CCTTCCAAGGTCTTGTGGCATC -3'

Sequencing Primer
(F):5'- CTCAGGGACTCTTTAGGCATATG -3'
(R):5'- GGTCTTGTGGCATCAACCAAATTG -3'
Posted On2020-06-30