Incidental Mutation 'R8086:2010315B03Rik'
ID629664
Institutional Source Beutler Lab
Gene Symbol 2010315B03Rik
Ensembl Gene ENSMUSG00000074829
Gene NameRIKEN cDNA 2010315B03 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R8086 (G1)
Quality Score218.009
Status Validated
Chromosome9
Chromosomal Location124291804-124312696 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124293178 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 372 (H372L)
Ref Sequence ENSEMBL: ENSMUSP00000137258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071300] [ENSMUST00000177714] [ENSMUST00000185949] [ENSMUST00000189915]
Predicted Effect probably benign
Transcript: ENSMUST00000071300
SMART Domains Protein: ENSMUSP00000071269
Gene: ENSMUSG00000074829

DomainStartEndE-ValueType
KRAB 24 86 5.28e-14 SMART
ZnF_C2H2 95 117 5.9e-3 SMART
ZnF_C2H2 123 145 1.26e-2 SMART
ZnF_C2H2 151 173 2.95e-3 SMART
ZnF_C2H2 179 201 4.24e-4 SMART
ZnF_C2H2 207 229 1.38e-3 SMART
ZnF_C2H2 235 257 3.21e-4 SMART
ZnF_C2H2 263 285 1.26e-2 SMART
ZnF_C2H2 291 312 6.08e0 SMART
ZnF_C2H2 318 340 8.6e-5 SMART
ZnF_C2H2 346 368 1.36e-2 SMART
ZnF_C2H2 374 396 8.02e-5 SMART
ZnF_C2H2 402 424 9.58e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000137258
Gene: ENSMUSG00000074829
AA Change: H372L

DomainStartEndE-ValueType
KRAB 28 90 5.28e-14 SMART
ZnF_C2H2 99 121 5.9e-3 SMART
ZnF_C2H2 127 149 1.26e-2 SMART
ZnF_C2H2 155 177 2.95e-3 SMART
ZnF_C2H2 183 205 4.24e-4 SMART
ZnF_C2H2 211 233 1.38e-3 SMART
ZnF_C2H2 239 261 3.21e-4 SMART
ZnF_C2H2 267 289 1.26e-2 SMART
ZnF_C2H2 295 316 6.08e0 SMART
ZnF_C2H2 322 344 8.6e-5 SMART
ZnF_C2H2 350 372 1.36e-2 SMART
ZnF_C2H2 378 400 8.02e-5 SMART
ZnF_C2H2 406 428 9.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185949
SMART Domains Protein: ENSMUSP00000140144
Gene: ENSMUSG00000074829

DomainStartEndE-ValueType
KRAB 29 91 2.3e-16 SMART
ZnF_C2H2 100 122 2.5e-5 SMART
ZnF_C2H2 128 150 5.3e-5 SMART
ZnF_C2H2 156 175 5.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189915
SMART Domains Protein: ENSMUSP00000140738
Gene: ENSMUSG00000074829

DomainStartEndE-ValueType
KRAB 1 63 2.3e-16 SMART
ZnF_C2H2 72 94 2.5e-5 SMART
ZnF_C2H2 100 122 5.3e-5 SMART
ZnF_C2H2 128 150 1.2e-5 SMART
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik A G 2: 23,240,922 probably null Het
Abcb1a A T 5: 8,674,833 T89S probably benign Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Capn9 A T 8: 124,607,953 probably null Het
Cox4i1 T A 8: 120,674,040 M148K probably damaging Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dnajc3 G T 14: 118,970,780 E276* probably null Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hinfp C T 9: 44,298,989 R183Q probably damaging Het
Hpd T C 5: 123,176,189 Y221C probably benign Het
Hrnr A T 3: 93,323,421 H322L unknown Het
Il6st T A 13: 112,494,560 probably null Het
Impa1 T C 3: 10,322,928 K145E probably benign Het
Itga9 A T 9: 118,850,801 M847L probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Lrrfip1 T A 1: 91,115,908 H678Q probably benign Het
Mettl16 A G 11: 74,805,265 T311A probably benign Het
Nefl T C 14: 68,086,031 Y369H probably damaging Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Ramp2 T A 11: 101,247,936 L147Q probably damaging Het
Rassf1 C T 9: 107,557,974 R223C probably benign Het
Rcbtb2 T C 14: 73,173,865 F357L probably damaging Het
Rnf24 A G 2: 131,303,548 V114A probably benign Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tatdn2 T C 6: 113,709,521 S697P probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r237 T G 17: 21,314,247 D77E possibly damaging Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in 2010315B03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01872:2010315B03Rik APN 9 124295490 splice site probably benign
P4748:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0090:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0122:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0140:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0164:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0164:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0388:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0775:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0798:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R1467:2010315B03Rik UTSW 9 124295463 missense possibly damaging 0.91
R1569:2010315B03Rik UTSW 9 124293797 nonsense probably null
R2566:2010315B03Rik UTSW 9 124293071 missense probably damaging 0.97
R2566:2010315B03Rik UTSW 9 124293153 missense probably damaging 0.99
R3853:2010315B03Rik UTSW 9 124293346 missense probably damaging 1.00
R4092:2010315B03Rik UTSW 9 124293273 missense probably benign 0.03
R4109:2010315B03Rik UTSW 9 124295103 missense probably benign 0.01
R4646:2010315B03Rik UTSW 9 124293598 missense probably benign 0.00
R4648:2010315B03Rik UTSW 9 124293598 missense probably benign 0.00
R4705:2010315B03Rik UTSW 9 124294001 missense possibly damaging 0.86
R4764:2010315B03Rik UTSW 9 124293766 missense probably benign 0.01
R5110:2010315B03Rik UTSW 9 124295357 critical splice donor site probably null
R5117:2010315B03Rik UTSW 9 124293085 missense probably benign 0.00
R5162:2010315B03Rik UTSW 9 124293671 missense probably benign 0.08
R5226:2010315B03Rik UTSW 9 124294076 missense possibly damaging 0.91
R5426:2010315B03Rik UTSW 9 124294003 missense probably damaging 1.00
R6793:2010315B03Rik UTSW 9 124295422 missense possibly damaging 0.85
R6975:2010315B03Rik UTSW 9 124294057 missense probably benign 0.02
R7213:2010315B03Rik UTSW 9 124293900 nonsense probably null
R8011:2010315B03Rik UTSW 9 124293899 missense
R8117:2010315B03Rik UTSW 9 124295448 missense
R8363:2010315B03Rik UTSW 9 124293170 missense
Predicted Primers PCR Primer
(F):5'- ATGCTGTGGACAGTACTATGTT -3'
(R):5'- CATGCTGGACAGAAAGGCTATGAAT -3'

Sequencing Primer
(F):5'- GTTGTGCAAATATTTTACCAAATTGG -3'
(R):5'- CACTGTGATAAAGCCTTTGCAAGTC -3'
Posted On2020-06-30