Incidental Mutation 'R8086:Olfr412'
ID629666
Institutional Source Beutler Lab
Gene Symbol Olfr412
Ensembl Gene ENSMUSG00000058275
Gene Nameolfactory receptor 412
SynonymsMOR127-5P, GA_x6K02T2P1NL-4500587-4501525
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R8086 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location74362069-74366218 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74364954 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 95 (P95Q)
Ref Sequence ENSEMBL: ENSMUSP00000149922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077794] [ENSMUST00000216362]
Predicted Effect probably benign
Transcript: ENSMUST00000077794
AA Change: P95Q

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000076967
Gene: ENSMUSG00000058275
AA Change: P95Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.7e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 172 1.8e-8 PFAM
Pfam:7tm_1 41 289 3.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216362
AA Change: P95Q

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,178 H372L Het
4931423N10Rik A G 2: 23,240,922 probably null Het
Abcb1a A T 5: 8,674,833 T89S probably benign Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Capn9 A T 8: 124,607,953 probably null Het
Cox4i1 T A 8: 120,674,040 M148K probably damaging Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dnajc3 G T 14: 118,970,780 E276* probably null Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hinfp C T 9: 44,298,989 R183Q probably damaging Het
Hpd T C 5: 123,176,189 Y221C probably benign Het
Hrnr A T 3: 93,323,421 H322L unknown Het
Il6st T A 13: 112,494,560 probably null Het
Impa1 T C 3: 10,322,928 K145E probably benign Het
Itga9 A T 9: 118,850,801 M847L probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Lrrfip1 T A 1: 91,115,908 H678Q probably benign Het
Mettl16 A G 11: 74,805,265 T311A probably benign Het
Nefl T C 14: 68,086,031 Y369H probably damaging Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Ramp2 T A 11: 101,247,936 L147Q probably damaging Het
Rassf1 C T 9: 107,557,974 R223C probably benign Het
Rcbtb2 T C 14: 73,173,865 F357L probably damaging Het
Rnf24 A G 2: 131,303,548 V114A probably benign Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tatdn2 T C 6: 113,709,521 S697P probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r237 T G 17: 21,314,247 D77E possibly damaging Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in Olfr412
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Olfr412 APN 11 74364912 missense possibly damaging 0.82
IGL01395:Olfr412 APN 11 74364887 missense probably damaging 1.00
IGL01418:Olfr412 APN 11 74364984 missense possibly damaging 0.85
IGL01645:Olfr412 APN 11 74365533 missense possibly damaging 0.95
IGL02421:Olfr412 APN 11 74365191 missense probably damaging 1.00
IGL02424:Olfr412 APN 11 74365473 missense probably benign 0.09
R0206:Olfr412 UTSW 11 74365142 missense probably benign 0.00
R0206:Olfr412 UTSW 11 74365142 missense probably benign 0.00
R0278:Olfr412 UTSW 11 74365202 missense probably damaging 1.00
R0698:Olfr412 UTSW 11 74365142 missense probably benign 0.00
R1424:Olfr412 UTSW 11 74364954 missense probably benign 0.05
R1549:Olfr412 UTSW 11 74365250 missense probably benign 0.00
R1659:Olfr412 UTSW 11 74364933 missense probably benign 0.01
R1755:Olfr412 UTSW 11 74364993 missense probably damaging 1.00
R2031:Olfr412 UTSW 11 74364951 missense probably damaging 1.00
R2185:Olfr412 UTSW 11 74364746 missense probably benign
R3620:Olfr412 UTSW 11 74365224 missense probably damaging 1.00
R4568:Olfr412 UTSW 11 74365209 missense probably damaging 0.99
R4878:Olfr412 UTSW 11 74364848 missense probably damaging 1.00
R7779:Olfr412 UTSW 11 74364945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTACCTGGTCACAGTGG -3'
(R):5'- TACTCTGGTCATGAGGAGGG -3'

Sequencing Primer
(F):5'- GTGGGGAACGTGCTCATCATC -3'
(R):5'- CCATAAAGGATAGATAGGGCCC -3'
Posted On2020-06-30