Incidental Mutation 'R8086:Mettl16'
ID629667
Institutional Source Beutler Lab
Gene Symbol Mettl16
Ensembl Gene ENSMUSG00000010554
Gene Namemethyltransferase like 16
Synonyms2810013M15Rik, Mett10d, 2610100D03Rik, A830095F14Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8086 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location74770830-74828525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74805265 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 311 (T311A)
Ref Sequence ENSEMBL: ENSMUSP00000010698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010698] [ENSMUST00000092912] [ENSMUST00000141755]
Predicted Effect probably benign
Transcript: ENSMUST00000010698
AA Change: T311A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000010698
Gene: ENSMUSG00000010554
AA Change: T311A

DomainStartEndE-ValueType
Pfam:Methyltransf_10 1 268 2.9e-114 PFAM
Pfam:MTS 92 202 1.8e-7 PFAM
Pfam:Methyltransf_10 276 331 5.5e-21 PFAM
low complexity region 421 437 N/A INTRINSIC
low complexity region 497 518 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092912
SMART Domains Protein: ENSMUSP00000090590
Gene: ENSMUSG00000010554

DomainStartEndE-ValueType
Pfam:Methyltransf_10 1 211 7.8e-97 PFAM
Pfam:PrmA 85 185 6.5e-7 PFAM
Pfam:MTS 92 200 1.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141755
AA Change: T271A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000114682
Gene: ENSMUSG00000010554
AA Change: T271A

DomainStartEndE-ValueType
Pfam:Methyltransf_10 1 291 4.8e-138 PFAM
low complexity region 381 397 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,178 H372L Het
4931423N10Rik A G 2: 23,240,922 probably null Het
Abcb1a A T 5: 8,674,833 T89S probably benign Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Capn9 A T 8: 124,607,953 probably null Het
Cox4i1 T A 8: 120,674,040 M148K probably damaging Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dnajc3 G T 14: 118,970,780 E276* probably null Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hinfp C T 9: 44,298,989 R183Q probably damaging Het
Hpd T C 5: 123,176,189 Y221C probably benign Het
Hrnr A T 3: 93,323,421 H322L unknown Het
Impa1 T C 3: 10,322,928 K145E probably benign Het
Itga9 A T 9: 118,850,801 M847L probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Lactbl1 C T 4: 136,637,519 A394V probably benign Het
Lrrfip1 T A 1: 91,115,908 H678Q probably benign Het
Nefl T C 14: 68,086,031 Y369H probably damaging Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Peg10 C CTCT 6: 4,756,453 probably benign Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Ramp2 T A 11: 101,247,936 L147Q probably damaging Het
Rassf1 C T 9: 107,557,974 R223C probably benign Het
Rcbtb2 T C 14: 73,173,865 F357L probably damaging Het
Rnf24 A G 2: 131,303,548 V114A probably benign Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tatdn2 T C 6: 113,709,521 S697P probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r237 T G 17: 21,314,247 D77E possibly damaging Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in Mettl16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Mettl16 APN 11 74817366 missense probably benign 0.11
IGL01538:Mettl16 APN 11 74792267 nonsense probably null
IGL01893:Mettl16 APN 11 74805271 missense possibly damaging 0.84
IGL02079:Mettl16 APN 11 74817624 missense probably damaging 1.00
IGL03217:Mettl16 APN 11 74817703 missense probably damaging 1.00
R2014:Mettl16 UTSW 11 74817369 missense probably benign
R2117:Mettl16 UTSW 11 74802929 missense probably benign
R4042:Mettl16 UTSW 11 74792292 missense probably damaging 1.00
R4773:Mettl16 UTSW 11 74817301 missense possibly damaging 0.49
R5031:Mettl16 UTSW 11 74802999 missense probably benign
R5056:Mettl16 UTSW 11 74816940 missense probably benign 0.34
R5951:Mettl16 UTSW 11 74795997 missense possibly damaging 0.71
R5986:Mettl16 UTSW 11 74792237 missense possibly damaging 0.51
R6012:Mettl16 UTSW 11 74787648 missense probably damaging 1.00
R6314:Mettl16 UTSW 11 74796006 nonsense probably null
R6450:Mettl16 UTSW 11 74805338 missense probably benign 0.02
R7744:Mettl16 UTSW 11 74803003 missense probably benign 0.08
R8160:Mettl16 UTSW 11 74817679 missense probably damaging 0.99
X0012:Mettl16 UTSW 11 74817025 missense probably benign 0.02
X0028:Mettl16 UTSW 11 74817044 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAACAGGAGTTAGCAGCCAG -3'
(R):5'- CCATAAACATCTGGATAAAACTTGAGG -3'

Sequencing Primer
(F):5'- CACGAGTAGAGAGGCTTTAGTGTG -3'
(R):5'- ACATCTGGATAAAACTTGAGGAAAAC -3'
Posted On2020-06-30