Incidental Mutation 'R8086:Ramp2'
ID629668
Institutional Source Beutler Lab
Gene Symbol Ramp2
Ensembl Gene ENSMUSG00000001240
Gene Namereceptor (calcitonin) activity modifying protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8086 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101246028-101259546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101247936 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 147 (L147Q)
Ref Sequence ENSEMBL: ENSMUSP00000122072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107282] [ENSMUST00000122006] [ENSMUST00000128260] [ENSMUST00000129680] [ENSMUST00000149585] [ENSMUST00000151830]
Predicted Effect probably damaging
Transcript: ENSMUST00000107282
AA Change: L99Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102903
Gene: ENSMUSG00000001240
AA Change: L99Q

DomainStartEndE-ValueType
Pfam:RAMP 29 140 1.5e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122006
SMART Domains Protein: ENSMUSP00000114061
Gene: ENSMUSG00000001240

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
PDB:2XVT|F 71 105 3e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000128260
SMART Domains Protein: ENSMUSP00000127718
Gene: ENSMUSG00000001240

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129680
AA Change: L147Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122072
Gene: ENSMUSG00000001240
AA Change: L147Q

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
Pfam:RAMP 80 187 6.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149585
SMART Domains Protein: ENSMUSP00000116331
Gene: ENSMUSG00000001240

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151830
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RAMP family of single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. RAMPs are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin-gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of this (RAMP2) protein, CRLR functions as an adrenomedullin receptor. The RAMP2 protein is involved in core glycosylation and transportation of adrenomedullin receptor to the cell surface. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality. Mice heterozygous for the null allele exhibit decreased litter size beyond the loss of homozygous embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,178 H372L Het
4931423N10Rik A G 2: 23,240,922 probably null Het
Abcb1a A T 5: 8,674,833 T89S probably benign Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Capn9 A T 8: 124,607,953 probably null Het
Cox4i1 T A 8: 120,674,040 M148K probably damaging Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dnajc3 G T 14: 118,970,780 E276* probably null Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hinfp C T 9: 44,298,989 R183Q probably damaging Het
Hpd T C 5: 123,176,189 Y221C probably benign Het
Hrnr A T 3: 93,323,421 H322L unknown Het
Il6st T A 13: 112,494,560 probably null Het
Impa1 T C 3: 10,322,928 K145E probably benign Het
Itga9 A T 9: 118,850,801 M847L probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Lrrfip1 T A 1: 91,115,908 H678Q probably benign Het
Mettl16 A G 11: 74,805,265 T311A probably benign Het
Nefl T C 14: 68,086,031 Y369H probably damaging Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Rassf1 C T 9: 107,557,974 R223C probably benign Het
Rcbtb2 T C 14: 73,173,865 F357L probably damaging Het
Rnf24 A G 2: 131,303,548 V114A probably benign Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tatdn2 T C 6: 113,709,521 S697P probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r237 T G 17: 21,314,247 D77E possibly damaging Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in Ramp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Ramp2 APN 11 101247627 missense probably benign 0.37
R1518:Ramp2 UTSW 11 101247582 missense probably benign 0.22
R2218:Ramp2 UTSW 11 101247631 missense probably benign 0.00
R2566:Ramp2 UTSW 11 101246545 unclassified probably benign
R3412:Ramp2 UTSW 11 101246545 unclassified probably benign
R4967:Ramp2 UTSW 11 101247557 splice site probably null
R4998:Ramp2 UTSW 11 101247421 intron probably benign
R7436:Ramp2 UTSW 11 101247939 missense possibly damaging 0.94
X0018:Ramp2 UTSW 11 101246545 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGAACATCCTTCTCCCTGTG -3'
(R):5'- TTTCCACCAATCCACAGGTC -3'

Sequencing Primer
(F):5'- GTGCCCATCCATTCCCTCAC -3'
(R):5'- ATTCCTGGTTCCAGCAGGG -3'
Posted On2020-06-30