Incidental Mutation 'R8086:Nefl'
ID629671
Institutional Source Beutler Lab
Gene Symbol Nefl
Ensembl Gene ENSMUSG00000022055
Gene Nameneurofilament, light polypeptide
SynonymsNfl, CMT2E, NF68, NF-L
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8086 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location68083863-68089095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68086031 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 369 (Y369H)
Ref Sequence ENSEMBL: ENSMUSP00000022639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022639] [ENSMUST00000111089]
Predicted Effect probably damaging
Transcript: ENSMUST00000022639
AA Change: Y369H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022639
Gene: ENSMUSG00000022055
AA Change: Y369H

DomainStartEndE-ValueType
Pfam:Filament_head 9 88 7e-14 PFAM
Filament 89 400 6.93e-139 SMART
low complexity region 448 470 N/A INTRINSIC
coiled coil region 473 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111089
SMART Domains Protein: ENSMUSP00000106718
Gene: ENSMUSG00000022054

DomainStartEndE-ValueType
Pfam:Filament_head 9 97 1.6e-16 PFAM
Pfam:Filament 98 403 1.1e-104 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and they functionally maintain the neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the light chain neurofilament protein. Mutations in this gene cause Charcot-Marie-Tooth disease types 1F (CMT1F) and 2E (CMT2E), disorders of the peripheral nervous system that are characterized by distinct neuropathies. A pseudogene has been identified on chromosome Y. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene lack neurofilaments in their axons and have motor axons that are reduced in both size and number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,178 H372L Het
4931423N10Rik A G 2: 23,240,922 probably null Het
Abcb1a A T 5: 8,674,833 T89S probably benign Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Capn9 A T 8: 124,607,953 probably null Het
Cox4i1 T A 8: 120,674,040 M148K probably damaging Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dnajc3 G T 14: 118,970,780 E276* probably null Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hinfp C T 9: 44,298,989 R183Q probably damaging Het
Hpd T C 5: 123,176,189 Y221C probably benign Het
Hrnr A T 3: 93,323,421 H322L unknown Het
Il6st T A 13: 112,494,560 probably null Het
Impa1 T C 3: 10,322,928 K145E probably benign Het
Itga9 A T 9: 118,850,801 M847L probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Lrrfip1 T A 1: 91,115,908 H678Q probably benign Het
Mettl16 A G 11: 74,805,265 T311A probably benign Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Ramp2 T A 11: 101,247,936 L147Q probably damaging Het
Rassf1 C T 9: 107,557,974 R223C probably benign Het
Rcbtb2 T C 14: 73,173,865 F357L probably damaging Het
Rnf24 A G 2: 131,303,548 V114A probably benign Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tatdn2 T C 6: 113,709,521 S697P probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r237 T G 17: 21,314,247 D77E possibly damaging Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in Nefl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Nefl APN 14 68086482 intron probably benign
IGL01755:Nefl APN 14 68086077 missense probably damaging 1.00
IGL02825:Nefl APN 14 68084346 missense possibly damaging 0.96
IGL03297:Nefl APN 14 68084224 missense possibly damaging 0.55
PIT4418001:Nefl UTSW 14 68086530 missense probably damaging 0.99
R0503:Nefl UTSW 14 68083983 missense probably benign 0.08
R1837:Nefl UTSW 14 68086626 missense probably damaging 1.00
R1970:Nefl UTSW 14 68086672 missense probably benign 0.20
R4812:Nefl UTSW 14 68084285 missense probably damaging 1.00
R4972:Nefl UTSW 14 68086763 intron probably benign
R5361:Nefl UTSW 14 68084639 missense probably damaging 0.99
R6357:Nefl UTSW 14 68084318 missense probably damaging 1.00
R6499:Nefl UTSW 14 68084585 missense probably damaging 1.00
R7571:Nefl UTSW 14 68084674 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATTTTAGGCCAACCCCTC -3'
(R):5'- TAGGACTATTCTAGAGCACGTGG -3'

Sequencing Primer
(F):5'- CCCACCCCATTATTTTAAGGGAG -3'
(R):5'- GTGGGACTCACTATAACTGCACTG -3'
Posted On2020-06-30