Incidental Mutation 'R8086:Rcbtb2'
ID629672
Institutional Source Beutler Lab
Gene Symbol Rcbtb2
Ensembl Gene ENSMUSG00000022106
Gene Nameregulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2
SynonymsRc/btb2, Chc1l, 2610028E02Rik, 2810420M18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R8086 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location73123037-73207843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73173865 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 357 (F357L)
Ref Sequence ENSEMBL: ENSMUSP00000131588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022702] [ENSMUST00000110952] [ENSMUST00000163797] [ENSMUST00000164298] [ENSMUST00000164822] [ENSMUST00000167401] [ENSMUST00000169479] [ENSMUST00000169513] [ENSMUST00000170677] [ENSMUST00000171767]
Predicted Effect probably damaging
Transcript: ENSMUST00000022702
AA Change: F357L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022702
Gene: ENSMUSG00000022106
AA Change: F357L

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.1e-16 PFAM
Pfam:RCC1_2 154 183 7.1e-15 PFAM
Pfam:RCC1 170 220 1.7e-14 PFAM
Pfam:RCC1 223 272 7.1e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-12 PFAM
Pfam:RCC1 275 324 8e-16 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110952
AA Change: F357L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106577
Gene: ENSMUSG00000022106
AA Change: F357L

DomainStartEndE-ValueType
Pfam:RCC1 117 167 3e-16 PFAM
Pfam:RCC1_2 154 183 7.8e-15 PFAM
Pfam:RCC1 170 220 1.4e-15 PFAM
Pfam:RCC1 223 272 9.4e-18 PFAM
Pfam:RCC1_2 259 288 2.6e-11 PFAM
Pfam:RCC1 275 324 1.2e-13 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163797
SMART Domains Protein: ENSMUSP00000132125
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
Pfam:RCC1 136 174 7.7e-12 PFAM
low complexity region 199 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164298
SMART Domains Protein: ENSMUSP00000126651
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
Pfam:RCC1 103 153 2.9e-17 PFAM
Pfam:RCC1_2 140 169 2.2e-15 PFAM
Pfam:RCC1 156 206 4.4e-15 PFAM
Pfam:RCC1 209 247 1.2e-11 PFAM
low complexity region 272 280 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164822
AA Change: F357L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131588
Gene: ENSMUSG00000022106
AA Change: F357L

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.1e-16 PFAM
Pfam:RCC1_2 154 183 7.1e-15 PFAM
Pfam:RCC1 170 220 1.7e-14 PFAM
Pfam:RCC1 223 272 7.1e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-12 PFAM
Pfam:RCC1 275 324 8e-16 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166875
SMART Domains Protein: ENSMUSP00000130168
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
BTB 32 118 1.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167401
Predicted Effect probably damaging
Transcript: ENSMUST00000169479
AA Change: F357L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126898
Gene: ENSMUSG00000022106
AA Change: F357L

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.1e-16 PFAM
Pfam:RCC1_2 154 183 7.1e-15 PFAM
Pfam:RCC1 170 220 1.7e-14 PFAM
Pfam:RCC1 223 272 7.1e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-12 PFAM
Pfam:RCC1 275 324 8e-16 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169513
AA Change: F333L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128579
Gene: ENSMUSG00000022106
AA Change: F333L

DomainStartEndE-ValueType
Pfam:RCC1 93 143 3.1e-16 PFAM
Pfam:RCC1_2 130 159 1.9e-14 PFAM
Pfam:RCC1 146 196 4.7e-14 PFAM
Pfam:RCC1 199 248 1.9e-17 PFAM
Pfam:RCC1_2 235 264 4.4e-12 PFAM
Pfam:RCC1 251 300 2.2e-15 PFAM
BTB 370 463 2.69e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170677
AA Change: F333L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126510
Gene: ENSMUSG00000022106
AA Change: F333L

DomainStartEndE-ValueType
Pfam:RCC1 93 143 3.1e-16 PFAM
Pfam:RCC1_2 130 159 1.9e-14 PFAM
Pfam:RCC1 146 196 4.7e-14 PFAM
Pfam:RCC1 199 248 1.9e-17 PFAM
Pfam:RCC1_2 235 264 4.4e-12 PFAM
Pfam:RCC1 251 300 2.2e-15 PFAM
BTB 370 463 2.69e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171767
AA Change: F357L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127397
Gene: ENSMUSG00000022106
AA Change: F357L

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.7e-16 PFAM
Pfam:RCC1_2 154 183 4.9e-15 PFAM
Pfam:RCC1 170 220 8.4e-16 PFAM
Pfam:RCC1 223 272 5.5e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-11 PFAM
Pfam:RCC1 275 324 6.8e-14 PFAM
BTB 394 487 2.69e-21 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two C-terminal BTB/POZ domains that is related to regulator of chromosome condensation (RCC). The encoded protein may act as a guanine nucleotide exchange factor. This gene is observed to be lost or underexpressed in prostate cancers. There is a pseudogene of this gene on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,178 H372L Het
4931423N10Rik A G 2: 23,240,922 probably null Het
Abcb1a A T 5: 8,674,833 T89S probably benign Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Capn9 A T 8: 124,607,953 probably null Het
Cox4i1 T A 8: 120,674,040 M148K probably damaging Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dnajc3 G T 14: 118,970,780 E276* probably null Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hinfp C T 9: 44,298,989 R183Q probably damaging Het
Hpd T C 5: 123,176,189 Y221C probably benign Het
Hrnr A T 3: 93,323,421 H322L unknown Het
Il6st T A 13: 112,494,560 probably null Het
Impa1 T C 3: 10,322,928 K145E probably benign Het
Itga9 A T 9: 118,850,801 M847L probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Lrrfip1 T A 1: 91,115,908 H678Q probably benign Het
Mettl16 A G 11: 74,805,265 T311A probably benign Het
Nefl T C 14: 68,086,031 Y369H probably damaging Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Ramp2 T A 11: 101,247,936 L147Q probably damaging Het
Rassf1 C T 9: 107,557,974 R223C probably benign Het
Rnf24 A G 2: 131,303,548 V114A probably benign Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tatdn2 T C 6: 113,709,521 S697P probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r237 T G 17: 21,314,247 D77E possibly damaging Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in Rcbtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Rcbtb2 APN 14 73164782 missense possibly damaging 0.94
IGL02550:Rcbtb2 APN 14 73162019 missense probably damaging 1.00
IGL02800:Rcbtb2 APN 14 73168103 nonsense probably null
IGL02811:Rcbtb2 APN 14 73174411 missense probably damaging 1.00
R0319:Rcbtb2 UTSW 14 73178469 missense probably benign 0.04
R0390:Rcbtb2 UTSW 14 73178547 missense probably damaging 0.96
R0448:Rcbtb2 UTSW 14 73178429 splice site probably benign
R1298:Rcbtb2 UTSW 14 73162388 missense probably damaging 0.99
R1567:Rcbtb2 UTSW 14 73162462 missense probably benign 0.07
R2014:Rcbtb2 UTSW 14 73174386 splice site probably benign
R2137:Rcbtb2 UTSW 14 73162051 missense probably damaging 1.00
R2218:Rcbtb2 UTSW 14 73178565 critical splice donor site probably null
R4505:Rcbtb2 UTSW 14 73173905 missense probably damaging 1.00
R5832:Rcbtb2 UTSW 14 73166822 missense possibly damaging 0.95
R5898:Rcbtb2 UTSW 14 73161965 nonsense probably null
R6484:Rcbtb2 UTSW 14 73177050 missense probably damaging 0.99
R7252:Rcbtb2 UTSW 14 73166780 missense probably damaging 1.00
R7606:Rcbtb2 UTSW 14 73182366 splice site probably null
R7654:Rcbtb2 UTSW 14 73174501 missense probably benign 0.00
R7762:Rcbtb2 UTSW 14 73178466 missense probably benign
R7951:Rcbtb2 UTSW 14 73166552 nonsense probably null
R7960:Rcbtb2 UTSW 14 73161944 missense probably benign 0.01
R8366:Rcbtb2 UTSW 14 73207192 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCTGAGTCAAGTGCACTCG -3'
(R):5'- AATAGTTTTAGTTCCCCTCCCCAAG -3'

Sequencing Primer
(F):5'- AAGGAGAGGCCAGCTCTTGTC -3'
(R):5'- GGGCTCCCAGAAAGAGGTTC -3'
Posted On2020-06-30