Incidental Mutation 'R8086:Dnajc3'
ID629673
Institutional Source Beutler Lab
Gene Symbol Dnajc3
Ensembl Gene ENSMUSG00000022136
Gene NameDnaJ heat shock protein family (Hsp40) member C3
SynonymsDnajc3, Dnajc3a, Dnajc3b, mp58, p58IPK, Prkri
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R8086 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location118937976-118981697 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 118970780 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 276 (E276*)
Ref Sequence ENSEMBL: ENSMUSP00000022734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022734]
PDB Structure
Crystal Structure of P58(IPK) TPR Domain at 2.5 A [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000022734
AA Change: E276*
SMART Domains Protein: ENSMUSP00000022734
Gene: ENSMUSG00000022136
AA Change: E276*

DomainStartEndE-ValueType
TPR 37 70 2.02e1 SMART
TPR 71 104 2.52e-1 SMART
TPR 105 138 4.99e-5 SMART
TPR 188 221 1.16e0 SMART
TPR 222 255 4.96e0 SMART
TPR 306 339 4.1e1 SMART
TPR 340 373 6.58e-5 SMART
DnaJ 393 454 6.88e-26 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple tetratricopeptide repeat (TPR) motifs as well as the highly conserved J domain found in DNAJ chaperone family members. It is a member of the tetratricopeptide repeat family of proteins and acts as an inhibitor of the interferon-induced, dsRNA-activated protein kinase (PKR). [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mice are smaller in size, have a lower percentage of body fat and develop a gradual onset of glucosuria and hyperglycemia associated with increasing apoptosis of pancreatic islet cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,178 H372L Het
4931423N10Rik A G 2: 23,240,922 probably null Het
Abcb1a A T 5: 8,674,833 T89S probably benign Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Capn9 A T 8: 124,607,953 probably null Het
Cox4i1 T A 8: 120,674,040 M148K probably damaging Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hinfp C T 9: 44,298,989 R183Q probably damaging Het
Hpd T C 5: 123,176,189 Y221C probably benign Het
Hrnr A T 3: 93,323,421 H322L unknown Het
Il6st T A 13: 112,494,560 probably null Het
Impa1 T C 3: 10,322,928 K145E probably benign Het
Itga9 A T 9: 118,850,801 M847L probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Lrrfip1 T A 1: 91,115,908 H678Q probably benign Het
Mettl16 A G 11: 74,805,265 T311A probably benign Het
Nefl T C 14: 68,086,031 Y369H probably damaging Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Ramp2 T A 11: 101,247,936 L147Q probably damaging Het
Rassf1 C T 9: 107,557,974 R223C probably benign Het
Rcbtb2 T C 14: 73,173,865 F357L probably damaging Het
Rnf24 A G 2: 131,303,548 V114A probably benign Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tatdn2 T C 6: 113,709,521 S697P probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r237 T G 17: 21,314,247 D77E possibly damaging Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in Dnajc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Dnajc3 APN 14 118960862 critical splice donor site probably null
ghostly UTSW 14 118970780 nonsense probably null
vanishing UTSW 14 118972387 nonsense probably null
R1438:Dnajc3 UTSW 14 118968106 missense probably benign
R1712:Dnajc3 UTSW 14 118957895 missense probably damaging 1.00
R2257:Dnajc3 UTSW 14 118972702 missense probably benign
R2261:Dnajc3 UTSW 14 118960820 missense probably damaging 0.98
R2262:Dnajc3 UTSW 14 118960820 missense probably damaging 0.98
R2307:Dnajc3 UTSW 14 118953221 critical splice donor site probably null
R4963:Dnajc3 UTSW 14 118978173 missense probably benign 0.06
R4996:Dnajc3 UTSW 14 118972427 missense probably benign
R5398:Dnajc3 UTSW 14 118972387 nonsense probably null
R5539:Dnajc3 UTSW 14 118970747 missense probably damaging 0.98
R5988:Dnajc3 UTSW 14 118957964 missense possibly damaging 0.54
R6032:Dnajc3 UTSW 14 118968031 missense possibly damaging 0.69
R6032:Dnajc3 UTSW 14 118968031 missense possibly damaging 0.69
R7361:Dnajc3 UTSW 14 118938164 missense probably benign 0.01
R7486:Dnajc3 UTSW 14 118972404 missense probably benign 0.01
R8092:Dnajc3 UTSW 14 118970582 splice site probably null
R8517:Dnajc3 UTSW 14 118953177 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCTGCTTCATACAGAGAACTCTTC -3'
(R):5'- AACAGTGCAGTCACATTTCTG -3'

Sequencing Primer
(F):5'- GGATCACAAGCGGTGTTT -3'
(R):5'- AGTCACATTTCTGCACTCTCAG -3'
Posted On2020-06-30