Incidental Mutation 'R8086:Vmn1r237'
ID629675
Institutional Source Beutler Lab
Gene Symbol Vmn1r237
Ensembl Gene ENSMUSG00000058030
Gene Namevomeronasal 1 receptor 237
SynonymsV1rf3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R8086 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location21313963-21314912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 21314247 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 77 (D77E)
Ref Sequence ENSEMBL: ENSMUSP00000076531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077301]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077301
AA Change: D77E

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000076531
Gene: ENSMUSG00000058030
AA Change: D77E

DomainStartEndE-ValueType
Pfam:TAS2R 1 289 7.1e-17 PFAM
Pfam:V1R 34 289 1.9e-34 PFAM
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,178 H372L Het
4931423N10Rik A G 2: 23,240,922 probably null Het
Abcb1a A T 5: 8,674,833 T89S probably benign Het
Ago1 A G 4: 126,460,981 V146A probably benign Het
App T C 16: 85,120,540 Y72C unknown Het
Arhgap20 T C 9: 51,849,263 S805P probably benign Het
Bak1 T A 17: 27,020,937 R208S probably benign Het
Btnl4 A C 17: 34,474,002 probably null Het
Cacng7 T C 7: 3,339,002 S134P probably benign Het
Capn9 A T 8: 124,607,953 probably null Het
Cox4i1 T A 8: 120,674,040 M148K probably damaging Het
Ctnna1 A G 18: 35,152,660 I20V possibly damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnah14 C A 1: 181,766,232 T3380K probably damaging Het
Dnajc3 G T 14: 118,970,780 E276* probably null Het
Dock10 C A 1: 80,503,990 C1772F probably benign Het
Fank1 A T 7: 133,853,230 E26D possibly damaging Het
Fcgbp G T 7: 28,113,964 C2308F probably damaging Het
Fyco1 A T 9: 123,830,406 M235K probably damaging Het
Gm7361 C T 5: 26,260,448 R148C probably damaging Het
Hinfp C T 9: 44,298,989 R183Q probably damaging Het
Hpd T C 5: 123,176,189 Y221C probably benign Het
Hrnr A T 3: 93,323,421 H322L unknown Het
Il6st T A 13: 112,494,560 probably null Het
Impa1 T C 3: 10,322,928 K145E probably benign Het
Itga9 A T 9: 118,850,801 M847L probably benign Het
Itgb6 A G 2: 60,650,032 V320A probably damaging Het
Lrrfip1 T A 1: 91,115,908 H678Q probably benign Het
Mettl16 A G 11: 74,805,265 T311A probably benign Het
Nefl T C 14: 68,086,031 Y369H probably damaging Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Pkd1 A G 17: 24,581,214 Y2983C probably damaging Het
Prr5l C T 2: 101,741,364 E123K probably benign Het
Ptprq A T 10: 107,646,639 Y1024* probably null Het
Ramp2 T A 11: 101,247,936 L147Q probably damaging Het
Rassf1 C T 9: 107,557,974 R223C probably benign Het
Rcbtb2 T C 14: 73,173,865 F357L probably damaging Het
Rnf24 A G 2: 131,303,548 V114A probably benign Het
Slc7a1 T G 5: 148,352,089 N116T probably damaging Het
Sstr2 T C 11: 113,625,172 C306R probably damaging Het
Tatdn2 T C 6: 113,709,521 S697P probably damaging Het
Tmem67 T A 4: 12,040,738 N935I probably damaging Het
Trp73 G A 4: 154,116,595 P4S unknown Het
Vmn1r238 C T 18: 3,123,250 A55T probably damaging Het
Vsig10l C A 7: 43,465,452 A359E possibly damaging Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb25 A G 12: 76,349,149 V433A probably benign Het
Zfp180 C A 7: 24,106,110 D651E probably benign Het
Zfp979 T C 4: 147,613,547 D235G probably damaging Het
Other mutations in Vmn1r237
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Vmn1r237 APN 17 21314075 missense probably damaging 0.97
IGL02746:Vmn1r237 APN 17 21314218 missense possibly damaging 0.96
IGL03112:Vmn1r237 APN 17 21314106 nonsense probably null
IGL03351:Vmn1r237 APN 17 21314837 missense probably benign 0.06
BB009:Vmn1r237 UTSW 17 21314463 missense probably benign 0.01
BB019:Vmn1r237 UTSW 17 21314463 missense probably benign 0.01
R0478:Vmn1r237 UTSW 17 21314819 missense probably damaging 1.00
R0514:Vmn1r237 UTSW 17 21314670 missense possibly damaging 0.63
R0616:Vmn1r237 UTSW 17 21314623 missense probably damaging 1.00
R0865:Vmn1r237 UTSW 17 21314714 missense probably damaging 0.99
R1590:Vmn1r237 UTSW 17 21314039 missense probably damaging 0.99
R3022:Vmn1r237 UTSW 17 21314447 missense probably damaging 0.99
R4241:Vmn1r237 UTSW 17 21314663 missense possibly damaging 0.63
R4242:Vmn1r237 UTSW 17 21314663 missense possibly damaging 0.63
R4646:Vmn1r237 UTSW 17 21314138 missense probably benign 0.02
R5144:Vmn1r237 UTSW 17 21314426 missense possibly damaging 0.96
R5229:Vmn1r237 UTSW 17 21314371 missense probably benign 0.00
R5334:Vmn1r237 UTSW 17 21314680 missense probably benign 0.00
R5800:Vmn1r237 UTSW 17 21314807 missense probably benign 0.05
R5898:Vmn1r237 UTSW 17 21314551 missense probably damaging 0.99
R6190:Vmn1r237 UTSW 17 21314294 missense probably damaging 1.00
R6472:Vmn1r237 UTSW 17 21314354 missense probably benign 0.16
R6811:Vmn1r237 UTSW 17 21314386 missense probably benign 0.02
R7932:Vmn1r237 UTSW 17 21314463 missense probably benign 0.01
R8008:Vmn1r237 UTSW 17 21314194 missense probably damaging 1.00
X0011:Vmn1r237 UTSW 17 21314055 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CCTGGGCAACTCCTTCTTAG -3'
(R):5'- CCCTTAGGCGTGTAATGTTCC -3'

Sequencing Primer
(F):5'- GGGCAACTCCTTCTTAGTCTAC -3'
(R):5'- TTTACTAAGAATGACAGGGCCC -3'
Posted On2020-06-30