Mutagenetix > Incidental Mutations

Incidental Mutation 'R8087:Garnl3'

629686

Institutional Source

Beutler Lab

Gene Symbol

Garnl3

Ensembl Gene

ENSMUSG00000038860

Gene Name

GTPase activating RANGAP domain-like 3

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.181) question?

Stock #

R8087 (G1)

Quality Score

222.009

Status

Not validated

Chromosome

Chromosomal Location

32986224-33131654 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 33045536 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 196 (D196E)

Ref Sequence

ENSEMBL: ENSMUSP00000122576 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000137381]

Predicted Effect

probably benign
Transcript: ENSMUST00000049618
AA Change: D155E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860
AA Change: D155E

Domain	Start	End	E-Value	Type
Pfam:Rap_GAP	202	383	3.4e-73	PFAM
Pfam:CNH	475	780	3.5e-67	PFAM
low complexity region	793	804	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102810
AA Change: D151E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860
AA Change: D151E

Domain	Start	End	E-Value	Type
Pfam:Rap_GAP	198	385	4.6e-67	PFAM
Pfam:CNH	471	776	1.8e-68	PFAM
low complexity region	789	800	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137381
AA Change: D196E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 97.7%
20x: 83.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810011H11Rik	G	T	14: 32,785,969		probably benign	Het
4930451I11Rik	A	G	7: 126,830,880	V73A	possibly damaging	Het
A830010M20Rik	T	A	5: 107,485,087	Y264N	probably damaging	Het
Abcg1	T	C	17: 31,064,485	L48P	probably benign	Het
Ablim1	A	G	19: 57,182,256	W18R		Het
Acss1	A	G	2: 150,642,748	F192L	probably damaging	Het
Arhgap32	A	G	9: 32,257,028	N769S	probably benign	Het
BC004004	T	A	17: 29,294,090	L163I	probably damaging	Het
Bco1	A	T	8: 117,108,762	T151S	possibly damaging	Het
C1ra	G	A	6: 124,513,872	V75I	probably damaging	Het
Cadps	A	C	14: 12,536,380	W527G	probably damaging	Het
Calca	T	C	7: 114,632,574	N85D	probably benign	Het
Capn13	A	G	17: 73,316,284	L644P	probably damaging	Het
Ccdc57	T	C	11: 120,897,879	I381V	probably benign	Het
Ccr1	A	G	9: 123,964,334	V53A	probably benign	Het
Cd27	G	T	6: 125,233,362	A234D	possibly damaging	Het
Cnpy4	T	A	5: 138,190,270	V46E	probably damaging	Het
Cspp1	T	G	1: 10,104,264	D647E	possibly damaging	Het
Ctnnd1	A	T	2: 84,610,876	F660I	possibly damaging	Het
Dchs1	A	T	7: 105,753,499	S3279T	probably benign	Het
Ddx11	T	A	17: 66,149,993	Y772N	probably damaging	Het
Dgkd	T	A	1: 87,916,847	V245E	probably damaging	Het
Dmgdh	C	T	13: 93,703,871	T270I	possibly damaging	Het
E330009J07Rik	T	A	6: 40,418,592	D194V	possibly damaging	Het
Elac2	A	G	11: 64,979,208	H33R	probably benign	Het
Emilin1	T	A	5: 30,917,100	D228E	probably damaging	Het
F2rl1	A	G	13: 95,513,999	L125P	probably damaging	Het
Fam186a	A	G	15: 99,941,844	V2173A	possibly damaging	Het
Foxp4	C	A	17: 47,904,430	G30C	probably damaging	Het
Fyn	T	A	10: 39,529,557	L273*	probably null	Het
Glb1	A	T	9: 114,430,415	T220S	probably damaging	Het
Gm9268	A	T	7: 43,047,670	Y717F	probably benign	Het
Hsdl2	G	T	4: 59,592,228	A31S	unknown	Het
Irak3	T	A	10: 120,182,535	I103F	probably benign	Het
Khdrbs2	A	T	1: 32,414,976	M148L	probably benign	Het
Kif2c	A	T	4: 117,165,418	S500R	possibly damaging	Het
Kmt2c	T	C	5: 25,329,252	Y1500C	probably damaging	Het
Lrp2	T	C	2: 69,448,129	D3960G	probably damaging	Het
Map2k6	A	T	11: 110,490,176	I39L	probably benign	Het
Muc13	G	T	16: 33,799,027	Q48H	unknown	Het
Nlrp1b	A	T	11: 71,172,071	I721N	probably benign	Het
Ntsr1	A	T	2: 180,500,172		probably benign	Het
Nubp1	T	C	16: 10,420,348		probably null	Het
Olfr92	T	C	17: 37,111,548	I145V	probably benign	Het
Ovol3	A	C	7: 30,234,372	D108E	probably damaging	Het
Pcdhb4	C	A	18: 37,308,664	N342K	probably damaging	Het
Pcgf3	A	G	5: 108,486,236	D120G	probably benign	Het
Pde6b	T	C	5: 108,388,462	V8A	probably benign	Het
Pkhd1	G	T	1: 20,523,089	T1600K	probably damaging	Het
Pkp3	A	G	7: 141,087,638	I451V	possibly damaging	Het
Plce1	A	G	19: 38,736,521	T1439A	probably damaging	Het
Prr27	C	A	5: 87,846,309	N347K	probably benign	Het
Prss41	T	C	17: 23,837,102	Y259C	probably damaging	Het
Rasgef1b	T	C	5: 99,221,389	I457V	probably benign	Het
Rspry1	G	A	8: 94,654,297	V534M	probably benign	Het
Rxrb	T	C	17: 34,035,789	V306A	probably benign	Het
Sim1	T	C	10: 50,909,555	M240T	possibly damaging	Het
Slc22a4	A	T	11: 53,996,061	I285K	possibly damaging	Het
Slc4a2	GGCAGCAGCAGCAGCAGCA	GGCAGCAGCAGCAGCA	5: 24,438,749		probably benign	Het
Snx19	T	C	9: 30,464,402	M993T	probably benign	Het
Sstr2	G	A	11: 113,624,675	R140H	probably damaging	Het
Syne1	C	T	10: 5,333,034	R1553Q	probably benign	Het
Tchp	T	C	5: 114,719,604	I386T	probably damaging	Het
Traf7	G	T	17: 24,512,064	S304R	possibly damaging	Het
Trcg1	C	T	9: 57,248,674	L798F	probably damaging	Het
Ttc3	C	T	16: 94,442,953	P1272L	probably benign	Het
Ttf2	G	T	3: 100,964,096	A83E	probably damaging	Het
Uba3	T	A	6: 97,185,383	I421F	possibly damaging	Het
Ube3b	T	C	5: 114,412,489		probably null	Het
Ulk4	A	G	9: 121,266,251	L112P	probably damaging	Het
Unc5a	A	G	13: 54,996,172	N150S	probably damaging	Het
Vac14	A	T	8: 110,719,900	K760N	probably benign	Het
Vmn2r113	A	T	17: 22,958,737	I832L	possibly damaging	Het
Xpot	T	C	10: 121,601,327	I830V	probably benign	Het
Zfp101	G	A	17: 33,381,003	T593I	probably benign	Het
Zfp54	A	C	17: 21,434,998	T585P	probably damaging	Het
Zfp663	T	C	2: 165,353,759	D180G	probably benign	Het

Other mutations in Garnl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Garnl3	APN	2	33006816	missense	probably damaging	1.00
IGL01601:Garnl3	APN	2	32997689	nonsense	probably null
IGL01981:Garnl3	APN	2	32997729	missense	probably damaging	0.98
IGL02209:Garnl3	APN	2	33085930	missense	probably damaging	0.99
IGL02434:Garnl3	APN	2	33054205	missense	probably damaging	1.00
IGL02512:Garnl3	APN	2	33031138	missense	probably damaging	1.00
IGL02947:Garnl3	APN	2	33046594	missense	probably damaging	1.00
PIT4403001:Garnl3	UTSW	2	32990758	missense	probably damaging	1.00
R0123:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0134:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0225:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0551:Garnl3	UTSW	2	33016738	missense	probably damaging	1.00
R0691:Garnl3	UTSW	2	33085907	missense	probably damaging	1.00
R0693:Garnl3	UTSW	2	33085907	missense	probably damaging	1.00
R0737:Garnl3	UTSW	2	32990642	missense	probably damaging	0.98
R1350:Garnl3	UTSW	2	33052214	missense	probably damaging	1.00
R1691:Garnl3	UTSW	2	32997663	nonsense	probably null
R1791:Garnl3	UTSW	2	33034127	missense	probably benign	0.02
R1938:Garnl3	UTSW	2	33005200	missense	probably damaging	0.99
R2100:Garnl3	UTSW	2	33046645	missense	probably benign	0.35
R2316:Garnl3	UTSW	2	33005152	missense	probably damaging	1.00
R2353:Garnl3	UTSW	2	33064034	missense	probably damaging	1.00
R3161:Garnl3	UTSW	2	33034711	missense	probably damaging	1.00
R3839:Garnl3	UTSW	2	32989546	missense	probably benign	0.00
R3847:Garnl3	UTSW	2	32992228	missense	probably benign
R4871:Garnl3	UTSW	2	33087088	start codon destroyed	probably null	0.77
R5682:Garnl3	UTSW	2	33054173	missense	probably damaging	1.00
R5811:Garnl3	UTSW	2	33006899	missense	probably damaging	0.99
R6267:Garnl3	UTSW	2	33104880	missense	probably benign	0.20
R6502:Garnl3	UTSW	2	33006821	missense	possibly damaging	0.67
R6532:Garnl3	UTSW	2	33031119	missense	possibly damaging	0.87
R6639:Garnl3	UTSW	2	32989525	missense	possibly damaging	0.75
R6763:Garnl3	UTSW	2	33054196	missense	probably damaging	1.00
R6866:Garnl3	UTSW	2	33002773	splice site	probably null
R6913:Garnl3	UTSW	2	32986829	missense	possibly damaging	0.91
R7002:Garnl3	UTSW	2	33054193	missense	possibly damaging	0.65
R7168:Garnl3	UTSW	2	32995078	missense	probably damaging	1.00
R7341:Garnl3	UTSW	2	33034129	missense	probably damaging	1.00
R7746:Garnl3	UTSW	2	32992257	missense	probably damaging	1.00
R7919:Garnl3	UTSW	2	33046599	missense	probably benign	0.38
R8079:Garnl3	UTSW	2	33018499	critical splice donor site	probably null
R8123:Garnl3	UTSW	2	33104938	missense	probably damaging	0.97
R8170:Garnl3	UTSW	2	33015223	missense	possibly damaging	0.88
R8347:Garnl3	UTSW	2	33085891	missense	probably damaging	1.00
R8418:Garnl3	UTSW	2	33052146	missense	possibly damaging	0.73
X0022:Garnl3	UTSW	2	33022668	missense	probably damaging	1.00
X0023:Garnl3	UTSW	2	33026149	missense	probably damaging	1.00
X0024:Garnl3	UTSW	2	33005179	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGCTCTGGTGACTAGCATCC -3'
(R):5'- ACATGGCAATTGGTGAAGTTCG -3'

Sequencing Primer
(F):5'- TACCTGATAACCTGCCCCCAATTATG -3'
(R):5'- GAAGTTCGTGGATTCTCTCATTC -3'

Posted On

2020-06-30