Incidental Mutation 'R8087:Ube3b'
ID 629703
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
Synonyms
MMRRC Submission 067520-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8087 (G1)
Quality Score 160.009
Status Not validated
Chromosome 5
Chromosomal Location 114518668-114559230 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 114550550 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
AlphaFold Q9ES34
Predicted Effect probably null
Transcript: ENSMUST00000074002
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196651
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.7%
  • 20x: 83.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik A G 7: 126,430,052 (GRCm39) V73A possibly damaging Het
Abcg1 T C 17: 31,283,459 (GRCm39) L48P probably benign Het
Ablim1 A G 19: 57,170,688 (GRCm39) W18R Het
Acss1 A G 2: 150,484,668 (GRCm39) F192L probably damaging Het
Arhgap32 A G 9: 32,168,324 (GRCm39) N769S probably benign Het
BC004004 T A 17: 29,513,064 (GRCm39) L163I probably damaging Het
Bco1 A T 8: 117,835,501 (GRCm39) T151S possibly damaging Het
Btbd8 T A 5: 107,632,953 (GRCm39) Y264N probably damaging Het
C1ra G A 6: 124,490,831 (GRCm39) V75I probably damaging Het
Cadps A C 14: 12,536,380 (GRCm38) W527G probably damaging Het
Calca T C 7: 114,231,809 (GRCm39) N85D probably benign Het
Capn13 A G 17: 73,623,279 (GRCm39) L644P probably damaging Het
Ccdc57 T C 11: 120,788,705 (GRCm39) I381V probably benign Het
Ccr1 A G 9: 123,764,371 (GRCm39) V53A probably benign Het
Cd27 G T 6: 125,210,325 (GRCm39) A234D possibly damaging Het
Cnpy4 T A 5: 138,188,532 (GRCm39) V46E probably damaging Het
Cspp1 T G 1: 10,174,489 (GRCm39) D647E possibly damaging Het
Ctnnd1 A T 2: 84,441,220 (GRCm39) F660I possibly damaging Het
Dchs1 A T 7: 105,402,706 (GRCm39) S3279T probably benign Het
Ddx11 T A 17: 66,456,988 (GRCm39) Y772N probably damaging Het
Dennd11 T A 6: 40,395,526 (GRCm39) D194V possibly damaging Het
Dgkd T A 1: 87,844,569 (GRCm39) V245E probably damaging Het
Dmgdh C T 13: 93,840,379 (GRCm39) T270I possibly damaging Het
Elac2 A G 11: 64,870,034 (GRCm39) H33R probably benign Het
Emilin1 T A 5: 31,074,444 (GRCm39) D228E probably damaging Het
F2rl1 A G 13: 95,650,507 (GRCm39) L125P probably damaging Het
Fam186a A G 15: 99,839,725 (GRCm39) V2173A possibly damaging Het
Foxp4 C A 17: 48,215,355 (GRCm39) G30C probably damaging Het
Fyn T A 10: 39,405,553 (GRCm39) L273* probably null Het
Garnl3 G T 2: 32,935,548 (GRCm39) D196E probably benign Het
Glb1 A T 9: 114,259,483 (GRCm39) T220S probably damaging Het
Hsdl2 G T 4: 59,592,228 (GRCm39) A31S unknown Het
Irak3 T A 10: 120,018,440 (GRCm39) I103F probably benign Het
Khdrbs2 A T 1: 32,454,057 (GRCm39) M148L probably benign Het
Kif2c A T 4: 117,022,615 (GRCm39) S500R possibly damaging Het
Kmt2c T C 5: 25,534,250 (GRCm39) Y1500C probably damaging Het
Lrp2 T C 2: 69,278,473 (GRCm39) D3960G probably damaging Het
Map2k6 A T 11: 110,381,002 (GRCm39) I39L probably benign Het
Muc13 G T 16: 33,619,397 (GRCm39) Q48H unknown Het
Nlrp1b A T 11: 71,062,897 (GRCm39) I721N probably benign Het
Ntsr1 A T 2: 180,141,965 (GRCm39) probably benign Het
Nubp1 T C 16: 10,238,212 (GRCm39) probably null Het
Or2h2c T C 17: 37,422,440 (GRCm39) I145V probably benign Het
Ovol3 A C 7: 29,933,797 (GRCm39) D108E probably damaging Het
Pcdhb4 C A 18: 37,441,717 (GRCm39) N342K probably damaging Het
Pcgf3 A G 5: 108,634,102 (GRCm39) D120G probably benign Het
Pde6b T C 5: 108,536,328 (GRCm39) V8A probably benign Het
Pkhd1 G T 1: 20,593,313 (GRCm39) T1600K probably damaging Het
Pkp3 A G 7: 140,667,551 (GRCm39) I451V possibly damaging Het
Plce1 A G 19: 38,724,965 (GRCm39) T1439A probably damaging Het
Prr27 C A 5: 87,994,168 (GRCm39) N347K probably benign Het
Prss41 T C 17: 24,056,076 (GRCm39) Y259C probably damaging Het
Rasgef1b T C 5: 99,369,248 (GRCm39) I457V probably benign Het
Rspry1 G A 8: 95,380,925 (GRCm39) V534M probably benign Het
Rxrb T C 17: 34,254,763 (GRCm39) V306A probably benign Het
Sim1 T C 10: 50,785,651 (GRCm39) M240T possibly damaging Het
Slc22a4 A T 11: 53,886,887 (GRCm39) I285K possibly damaging Het
Slc4a2 GGCAGCAGCAGCAGCAGCA GGCAGCAGCAGCAGCA 5: 24,643,747 (GRCm39) probably benign Het
Snx19 T C 9: 30,375,698 (GRCm39) M993T probably benign Het
Sstr2 G A 11: 113,515,501 (GRCm39) R140H probably damaging Het
Syne1 C T 10: 5,283,034 (GRCm39) R1553Q probably benign Het
Tchp T C 5: 114,857,665 (GRCm39) I386T probably damaging Het
Tmem273 G T 14: 32,507,926 (GRCm39) probably benign Het
Traf7 G T 17: 24,731,038 (GRCm39) S304R possibly damaging Het
Trcg1 C T 9: 57,155,957 (GRCm39) L798F probably damaging Het
Ttc3 C T 16: 94,243,812 (GRCm39) P1272L probably benign Het
Ttf2 G T 3: 100,871,412 (GRCm39) A83E probably damaging Het
Uba3 T A 6: 97,162,344 (GRCm39) I421F possibly damaging Het
Ulk4 A G 9: 121,095,317 (GRCm39) L112P probably damaging Het
Unc5a A G 13: 55,143,985 (GRCm39) N150S probably damaging Het
Vac14 A T 8: 111,446,532 (GRCm39) K760N probably benign Het
Vmn2r113 A T 17: 23,177,711 (GRCm39) I832L possibly damaging Het
Vmn2r-ps158 A T 7: 42,697,094 (GRCm39) Y717F probably benign Het
Xpot T C 10: 121,437,232 (GRCm39) I830V probably benign Het
Zfp101 G A 17: 33,599,977 (GRCm39) T593I probably benign Het
Zfp54 A C 17: 21,655,260 (GRCm39) T585P probably damaging Het
Zfp663 T C 2: 165,195,679 (GRCm39) D180G probably benign Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114,553,348 (GRCm39) missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114,544,313 (GRCm39) missense probably null 0.86
IGL02632:Ube3b APN 5 114,536,902 (GRCm39) missense probably benign
IGL02850:Ube3b APN 5 114,544,310 (GRCm39) missense probably damaging 1.00
IGL02878:Ube3b APN 5 114,542,778 (GRCm39) splice site probably null
IGL02881:Ube3b APN 5 114,550,945 (GRCm39) missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114,536,912 (GRCm39) missense probably benign 0.17
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0111:Ube3b UTSW 5 114,528,437 (GRCm39) splice site probably benign
R0309:Ube3b UTSW 5 114,557,530 (GRCm39) splice site probably benign
R0718:Ube3b UTSW 5 114,540,616 (GRCm39) nonsense probably null
R1344:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1350:Ube3b UTSW 5 114,544,198 (GRCm39) splice site probably null
R1418:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1732:Ube3b UTSW 5 114,525,506 (GRCm39) missense probably benign 0.01
R1764:Ube3b UTSW 5 114,542,678 (GRCm39) missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114,537,926 (GRCm39) missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2015:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2041:Ube3b UTSW 5 114,525,294 (GRCm39) missense probably damaging 0.99
R2074:Ube3b UTSW 5 114,553,316 (GRCm39) missense probably benign 0.14
R2202:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R2205:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R3826:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3829:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3830:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3927:Ube3b UTSW 5 114,553,741 (GRCm39) missense probably benign 0.03
R3974:Ube3b UTSW 5 114,550,491 (GRCm39) missense probably benign 0.05
R4049:Ube3b UTSW 5 114,550,931 (GRCm39) missense probably benign 0.09
R4096:Ube3b UTSW 5 114,531,147 (GRCm39) missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114,536,489 (GRCm39) missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114,550,505 (GRCm39) missense probably damaging 1.00
R4688:Ube3b UTSW 5 114,531,139 (GRCm39) missense probably benign 0.03
R4779:Ube3b UTSW 5 114,542,778 (GRCm39) splice site probably null
R4824:Ube3b UTSW 5 114,553,787 (GRCm39) splice site probably null
R4868:Ube3b UTSW 5 114,536,488 (GRCm39) missense probably benign 0.00
R4953:Ube3b UTSW 5 114,539,471 (GRCm39) missense probably benign 0.01
R5013:Ube3b UTSW 5 114,545,702 (GRCm39) missense probably damaging 1.00
R5057:Ube3b UTSW 5 114,544,318 (GRCm39) missense probably benign 0.01
R5117:Ube3b UTSW 5 114,557,692 (GRCm39) missense probably damaging 0.96
R5131:Ube3b UTSW 5 114,545,607 (GRCm39) missense probably damaging 1.00
R5498:Ube3b UTSW 5 114,556,635 (GRCm39) missense probably damaging 1.00
R5564:Ube3b UTSW 5 114,527,136 (GRCm39) missense probably damaging 1.00
R5572:Ube3b UTSW 5 114,544,240 (GRCm39) missense probably damaging 0.99
R5580:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R5596:Ube3b UTSW 5 114,544,221 (GRCm39) splice site probably null
R5843:Ube3b UTSW 5 114,550,360 (GRCm39) missense probably damaging 1.00
R5910:Ube3b UTSW 5 114,553,370 (GRCm39) missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R6691:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R7148:Ube3b UTSW 5 114,544,313 (GRCm39) missense probably damaging 0.97
R7334:Ube3b UTSW 5 114,553,742 (GRCm39) missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114,556,687 (GRCm39) missense probably damaging 1.00
R7438:Ube3b UTSW 5 114,553,345 (GRCm39) missense possibly damaging 0.79
R7640:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R7825:Ube3b UTSW 5 114,539,373 (GRCm39) missense probably damaging 1.00
R7958:Ube3b UTSW 5 114,539,484 (GRCm39) missense probably benign 0.05
R8025:Ube3b UTSW 5 114,546,270 (GRCm39) missense probably damaging 0.99
R8058:Ube3b UTSW 5 114,544,846 (GRCm39) missense possibly damaging 0.58
R8182:Ube3b UTSW 5 114,530,199 (GRCm39) missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114,540,747 (GRCm39) missense probably benign 0.04
R8465:Ube3b UTSW 5 114,528,451 (GRCm39) missense probably damaging 1.00
R8682:Ube3b UTSW 5 114,550,351 (GRCm39) missense probably damaging 1.00
R8708:Ube3b UTSW 5 114,531,151 (GRCm39) missense probably benign 0.34
R8758:Ube3b UTSW 5 114,553,261 (GRCm39) critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114,526,800 (GRCm39) missense probably damaging 1.00
R9058:Ube3b UTSW 5 114,553,300 (GRCm39) missense probably benign 0.05
R9072:Ube3b UTSW 5 114,542,607 (GRCm39) missense probably damaging 0.98
R9116:Ube3b UTSW 5 114,542,837 (GRCm39) intron probably benign
R9537:Ube3b UTSW 5 114,525,245 (GRCm39) missense probably damaging 1.00
R9596:Ube3b UTSW 5 114,527,171 (GRCm39) missense probably damaging 1.00
R9632:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
R9710:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
X0017:Ube3b UTSW 5 114,553,646 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CTTCTACAGCTCCGTGGATG -3'
(R):5'- ACCCTTGTCCAAACATTTGC -3'

Sequencing Primer
(F):5'- TCCATCAAGGTTAGTGCTGAC -3'
(R):5'- AACATTTGCACTGAGGCTGC -3'
Posted On 2020-06-30