Incidental Mutation 'R8087:Ube3b'
ID629703
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Nameubiquitin protein ligase E3B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8087 (G1)
Quality Score160.009
Status Not validated
Chromosome5
Chromosomal Location114380607-114421169 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 114412489 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
Predicted Effect probably null
Transcript: ENSMUST00000074002
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196651
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.7%
  • 20x: 83.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik G T 14: 32,785,969 probably benign Het
4930451I11Rik A G 7: 126,830,880 V73A possibly damaging Het
A830010M20Rik T A 5: 107,485,087 Y264N probably damaging Het
Abcg1 T C 17: 31,064,485 L48P probably benign Het
Ablim1 A G 19: 57,182,256 W18R Het
Acss1 A G 2: 150,642,748 F192L probably damaging Het
Arhgap32 A G 9: 32,257,028 N769S probably benign Het
BC004004 T A 17: 29,294,090 L163I probably damaging Het
Bco1 A T 8: 117,108,762 T151S possibly damaging Het
C1ra G A 6: 124,513,872 V75I probably damaging Het
Cadps A C 14: 12,536,380 W527G probably damaging Het
Calca T C 7: 114,632,574 N85D probably benign Het
Capn13 A G 17: 73,316,284 L644P probably damaging Het
Ccdc57 T C 11: 120,897,879 I381V probably benign Het
Ccr1 A G 9: 123,964,334 V53A probably benign Het
Cd27 G T 6: 125,233,362 A234D possibly damaging Het
Cnpy4 T A 5: 138,190,270 V46E probably damaging Het
Cspp1 T G 1: 10,104,264 D647E possibly damaging Het
Ctnnd1 A T 2: 84,610,876 F660I possibly damaging Het
Dchs1 A T 7: 105,753,499 S3279T probably benign Het
Ddx11 T A 17: 66,149,993 Y772N probably damaging Het
Dgkd T A 1: 87,916,847 V245E probably damaging Het
Dmgdh C T 13: 93,703,871 T270I possibly damaging Het
E330009J07Rik T A 6: 40,418,592 D194V possibly damaging Het
Elac2 A G 11: 64,979,208 H33R probably benign Het
Emilin1 T A 5: 30,917,100 D228E probably damaging Het
F2rl1 A G 13: 95,513,999 L125P probably damaging Het
Fam186a A G 15: 99,941,844 V2173A possibly damaging Het
Foxp4 C A 17: 47,904,430 G30C probably damaging Het
Fyn T A 10: 39,529,557 L273* probably null Het
Garnl3 G T 2: 33,045,536 D196E probably benign Het
Glb1 A T 9: 114,430,415 T220S probably damaging Het
Gm9268 A T 7: 43,047,670 Y717F probably benign Het
Hsdl2 G T 4: 59,592,228 A31S unknown Het
Irak3 T A 10: 120,182,535 I103F probably benign Het
Khdrbs2 A T 1: 32,414,976 M148L probably benign Het
Kif2c A T 4: 117,165,418 S500R possibly damaging Het
Kmt2c T C 5: 25,329,252 Y1500C probably damaging Het
Lrp2 T C 2: 69,448,129 D3960G probably damaging Het
Map2k6 A T 11: 110,490,176 I39L probably benign Het
Muc13 G T 16: 33,799,027 Q48H unknown Het
Nlrp1b A T 11: 71,172,071 I721N probably benign Het
Ntsr1 A T 2: 180,500,172 probably benign Het
Nubp1 T C 16: 10,420,348 probably null Het
Olfr92 T C 17: 37,111,548 I145V probably benign Het
Ovol3 A C 7: 30,234,372 D108E probably damaging Het
Pcdhb4 C A 18: 37,308,664 N342K probably damaging Het
Pcgf3 A G 5: 108,486,236 D120G probably benign Het
Pde6b T C 5: 108,388,462 V8A probably benign Het
Pkhd1 G T 1: 20,523,089 T1600K probably damaging Het
Pkp3 A G 7: 141,087,638 I451V possibly damaging Het
Plce1 A G 19: 38,736,521 T1439A probably damaging Het
Prr27 C A 5: 87,846,309 N347K probably benign Het
Prss41 T C 17: 23,837,102 Y259C probably damaging Het
Rasgef1b T C 5: 99,221,389 I457V probably benign Het
Rspry1 G A 8: 94,654,297 V534M probably benign Het
Rxrb T C 17: 34,035,789 V306A probably benign Het
Sim1 T C 10: 50,909,555 M240T possibly damaging Het
Slc22a4 A T 11: 53,996,061 I285K possibly damaging Het
Slc4a2 GGCAGCAGCAGCAGCAGCA GGCAGCAGCAGCAGCA 5: 24,438,749 probably benign Het
Snx19 T C 9: 30,464,402 M993T probably benign Het
Sstr2 G A 11: 113,624,675 R140H probably damaging Het
Syne1 C T 10: 5,333,034 R1553Q probably benign Het
Tchp T C 5: 114,719,604 I386T probably damaging Het
Traf7 G T 17: 24,512,064 S304R possibly damaging Het
Trcg1 C T 9: 57,248,674 L798F probably damaging Het
Ttc3 C T 16: 94,442,953 P1272L probably benign Het
Ttf2 G T 3: 100,964,096 A83E probably damaging Het
Uba3 T A 6: 97,185,383 I421F possibly damaging Het
Ulk4 A G 9: 121,266,251 L112P probably damaging Het
Unc5a A G 13: 54,996,172 N150S probably damaging Het
Vac14 A T 8: 110,719,900 K760N probably benign Het
Vmn2r113 A T 17: 22,958,737 I832L possibly damaging Het
Xpot T C 10: 121,601,327 I830V probably benign Het
Zfp101 G A 17: 33,381,003 T593I probably benign Het
Zfp54 A C 17: 21,434,998 T585P probably damaging Het
Zfp663 T C 2: 165,353,759 D180G probably benign Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114415287 missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114406252 missense probably null 0.86
IGL02632:Ube3b APN 5 114398841 missense probably benign
IGL02850:Ube3b APN 5 114406249 missense probably damaging 1.00
IGL02878:Ube3b APN 5 114404717 splice site probably null
IGL02881:Ube3b APN 5 114412884 missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114398851 missense probably benign 0.17
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0111:Ube3b UTSW 5 114390376 splice site probably benign
R0309:Ube3b UTSW 5 114419469 splice site probably benign
R0718:Ube3b UTSW 5 114402555 nonsense probably null
R1344:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1350:Ube3b UTSW 5 114406137 splice site probably null
R1418:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1732:Ube3b UTSW 5 114387445 missense probably benign 0.01
R1764:Ube3b UTSW 5 114404617 missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114399865 missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2015:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2041:Ube3b UTSW 5 114387233 missense probably damaging 0.99
R2074:Ube3b UTSW 5 114415255 missense probably benign 0.14
R2202:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R2205:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R3826:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3829:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3830:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3927:Ube3b UTSW 5 114415680 missense probably benign 0.03
R3974:Ube3b UTSW 5 114412430 missense probably benign 0.05
R4049:Ube3b UTSW 5 114412870 missense probably benign 0.09
R4096:Ube3b UTSW 5 114393086 missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114398428 missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114412444 missense probably damaging 1.00
R4688:Ube3b UTSW 5 114393078 missense probably benign 0.03
R4779:Ube3b UTSW 5 114404717 splice site probably null
R4824:Ube3b UTSW 5 114415726 splice site probably null
R4868:Ube3b UTSW 5 114398427 missense probably benign 0.00
R4953:Ube3b UTSW 5 114401410 missense probably benign 0.01
R5013:Ube3b UTSW 5 114407641 missense probably damaging 1.00
R5057:Ube3b UTSW 5 114406257 missense probably benign 0.01
R5117:Ube3b UTSW 5 114419631 missense probably damaging 0.96
R5131:Ube3b UTSW 5 114407546 missense probably damaging 1.00
R5498:Ube3b UTSW 5 114418574 missense probably damaging 1.00
R5564:Ube3b UTSW 5 114389075 missense probably damaging 1.00
R5572:Ube3b UTSW 5 114406179 missense probably damaging 0.99
R5580:Ube3b UTSW 5 114415323 missense probably benign
R5596:Ube3b UTSW 5 114406160 splice site probably null
R5843:Ube3b UTSW 5 114412299 missense probably damaging 1.00
R5910:Ube3b UTSW 5 114415309 missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114408124 missense probably benign 0.00
R6691:Ube3b UTSW 5 114408124 missense probably benign 0.00
R7148:Ube3b UTSW 5 114406252 missense probably damaging 0.97
R7334:Ube3b UTSW 5 114415681 missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114415284 missense possibly damaging 0.79
R7438:Ube3b UTSW 5 114418626 missense probably damaging 1.00
R7640:Ube3b UTSW 5 114415323 missense probably benign
R7825:Ube3b UTSW 5 114401312 missense probably damaging 1.00
R7958:Ube3b UTSW 5 114401423 missense probably benign 0.05
R8025:Ube3b UTSW 5 114408209 missense probably damaging 0.99
R8058:Ube3b UTSW 5 114406785 missense possibly damaging 0.58
R8182:Ube3b UTSW 5 114392138 missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114402686 missense probably benign 0.04
R8465:Ube3b UTSW 5 114390390 missense probably damaging 1.00
X0017:Ube3b UTSW 5 114415585 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CTTCTACAGCTCCGTGGATG -3'
(R):5'- ACCCTTGTCCAAACATTTGC -3'

Sequencing Primer
(F):5'- TCCATCAAGGTTAGTGCTGAC -3'
(R):5'- AACATTTGCACTGAGGCTGC -3'
Posted On2020-06-30