Mutagenetix > Incidental Mutations

Incidental Mutation 'R8087:Ube3b'

629703

Institutional Source

Beutler Lab

Gene Symbol

Ube3b

Ensembl Gene

ENSMUSG00000029577

Gene Name

ubiquitin protein ligase E3B

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8087 (G1)

Quality Score

160.009

Status

Not validated

Chromosome

Chromosomal Location

114380607-114421169 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 114412489 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000073652 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]

Predicted Effect

probably null
Transcript: ENSMUST00000074002

SMART Domains

Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
low complexity region	470	488	N/A	INTRINSIC
HECTc	697	1070	2.15e-110	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130169

SMART Domains

Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196651

SMART Domains

Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
HECTc	122	495	1.1e-112	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 97.7%
20x: 83.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810011H11Rik	G	T	14: 32,785,969		probably benign	Het
4930451I11Rik	A	G	7: 126,830,880	V73A	possibly damaging	Het
A830010M20Rik	T	A	5: 107,485,087	Y264N	probably damaging	Het
Abcg1	T	C	17: 31,064,485	L48P	probably benign	Het
Ablim1	A	G	19: 57,182,256	W18R		Het
Acss1	A	G	2: 150,642,748	F192L	probably damaging	Het
Arhgap32	A	G	9: 32,257,028	N769S	probably benign	Het
BC004004	T	A	17: 29,294,090	L163I	probably damaging	Het
Bco1	A	T	8: 117,108,762	T151S	possibly damaging	Het
C1ra	G	A	6: 124,513,872	V75I	probably damaging	Het
Cadps	A	C	14: 12,536,380	W527G	probably damaging	Het
Calca	T	C	7: 114,632,574	N85D	probably benign	Het
Capn13	A	G	17: 73,316,284	L644P	probably damaging	Het
Ccdc57	T	C	11: 120,897,879	I381V	probably benign	Het
Ccr1	A	G	9: 123,964,334	V53A	probably benign	Het
Cd27	G	T	6: 125,233,362	A234D	possibly damaging	Het
Cnpy4	T	A	5: 138,190,270	V46E	probably damaging	Het
Cspp1	T	G	1: 10,104,264	D647E	possibly damaging	Het
Ctnnd1	A	T	2: 84,610,876	F660I	possibly damaging	Het
Dchs1	A	T	7: 105,753,499	S3279T	probably benign	Het
Ddx11	T	A	17: 66,149,993	Y772N	probably damaging	Het
Dgkd	T	A	1: 87,916,847	V245E	probably damaging	Het
Dmgdh	C	T	13: 93,703,871	T270I	possibly damaging	Het
E330009J07Rik	T	A	6: 40,418,592	D194V	possibly damaging	Het
Elac2	A	G	11: 64,979,208	H33R	probably benign	Het
Emilin1	T	A	5: 30,917,100	D228E	probably damaging	Het
F2rl1	A	G	13: 95,513,999	L125P	probably damaging	Het
Fam186a	A	G	15: 99,941,844	V2173A	possibly damaging	Het
Foxp4	C	A	17: 47,904,430	G30C	probably damaging	Het
Fyn	T	A	10: 39,529,557	L273*	probably null	Het
Garnl3	G	T	2: 33,045,536	D196E	probably benign	Het
Glb1	A	T	9: 114,430,415	T220S	probably damaging	Het
Gm9268	A	T	7: 43,047,670	Y717F	probably benign	Het
Hsdl2	G	T	4: 59,592,228	A31S	unknown	Het
Irak3	T	A	10: 120,182,535	I103F	probably benign	Het
Khdrbs2	A	T	1: 32,414,976	M148L	probably benign	Het
Kif2c	A	T	4: 117,165,418	S500R	possibly damaging	Het
Kmt2c	T	C	5: 25,329,252	Y1500C	probably damaging	Het
Lrp2	T	C	2: 69,448,129	D3960G	probably damaging	Het
Map2k6	A	T	11: 110,490,176	I39L	probably benign	Het
Muc13	G	T	16: 33,799,027	Q48H	unknown	Het
Nlrp1b	A	T	11: 71,172,071	I721N	probably benign	Het
Ntsr1	A	T	2: 180,500,172		probably benign	Het
Nubp1	T	C	16: 10,420,348		probably null	Het
Olfr92	T	C	17: 37,111,548	I145V	probably benign	Het
Ovol3	A	C	7: 30,234,372	D108E	probably damaging	Het
Pcdhb4	C	A	18: 37,308,664	N342K	probably damaging	Het
Pcgf3	A	G	5: 108,486,236	D120G	probably benign	Het
Pde6b	T	C	5: 108,388,462	V8A	probably benign	Het
Pkhd1	G	T	1: 20,523,089	T1600K	probably damaging	Het
Pkp3	A	G	7: 141,087,638	I451V	possibly damaging	Het
Plce1	A	G	19: 38,736,521	T1439A	probably damaging	Het
Prr27	C	A	5: 87,846,309	N347K	probably benign	Het
Prss41	T	C	17: 23,837,102	Y259C	probably damaging	Het
Rasgef1b	T	C	5: 99,221,389	I457V	probably benign	Het
Rspry1	G	A	8: 94,654,297	V534M	probably benign	Het
Rxrb	T	C	17: 34,035,789	V306A	probably benign	Het
Sim1	T	C	10: 50,909,555	M240T	possibly damaging	Het
Slc22a4	A	T	11: 53,996,061	I285K	possibly damaging	Het
Slc4a2	GGCAGCAGCAGCAGCAGCA	GGCAGCAGCAGCAGCA	5: 24,438,749		probably benign	Het
Snx19	T	C	9: 30,464,402	M993T	probably benign	Het
Sstr2	G	A	11: 113,624,675	R140H	probably damaging	Het
Syne1	C	T	10: 5,333,034	R1553Q	probably benign	Het
Tchp	T	C	5: 114,719,604	I386T	probably damaging	Het
Traf7	G	T	17: 24,512,064	S304R	possibly damaging	Het
Trcg1	C	T	9: 57,248,674	L798F	probably damaging	Het
Ttc3	C	T	16: 94,442,953	P1272L	probably benign	Het
Ttf2	G	T	3: 100,964,096	A83E	probably damaging	Het
Uba3	T	A	6: 97,185,383	I421F	possibly damaging	Het
Ulk4	A	G	9: 121,266,251	L112P	probably damaging	Het
Unc5a	A	G	13: 54,996,172	N150S	probably damaging	Het
Vac14	A	T	8: 110,719,900	K760N	probably benign	Het
Vmn2r113	A	T	17: 22,958,737	I832L	possibly damaging	Het
Xpot	T	C	10: 121,601,327	I830V	probably benign	Het
Zfp101	G	A	17: 33,381,003	T593I	probably benign	Het
Zfp54	A	C	17: 21,434,998	T585P	probably damaging	Het
Zfp663	T	C	2: 165,353,759	D180G	probably benign	Het

Other mutations in Ube3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ube3b	APN	5	114415287	missense	possibly damaging	0.93
IGL01154:Ube3b	APN	5	114406252	missense	probably null	0.86
IGL02632:Ube3b	APN	5	114398841	missense	probably benign
IGL02850:Ube3b	APN	5	114406249	missense	probably damaging	1.00
IGL02878:Ube3b	APN	5	114404717	splice site	probably null
IGL02881:Ube3b	APN	5	114412884	missense	possibly damaging	0.78
R0003:Ube3b	UTSW	5	114398851	missense	probably benign	0.17
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0111:Ube3b	UTSW	5	114390376	splice site	probably benign
R0309:Ube3b	UTSW	5	114419469	splice site	probably benign
R0718:Ube3b	UTSW	5	114402555	nonsense	probably null
R1344:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1350:Ube3b	UTSW	5	114406137	splice site	probably null
R1418:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1732:Ube3b	UTSW	5	114387445	missense	probably benign	0.01
R1764:Ube3b	UTSW	5	114404617	missense	possibly damaging	0.89
R1975:Ube3b	UTSW	5	114399865	missense	possibly damaging	0.80
R2014:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2015:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2041:Ube3b	UTSW	5	114387233	missense	probably damaging	0.99
R2074:Ube3b	UTSW	5	114415255	missense	probably benign	0.14
R2202:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R2205:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R3826:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3829:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3830:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3927:Ube3b	UTSW	5	114415680	missense	probably benign	0.03
R3974:Ube3b	UTSW	5	114412430	missense	probably benign	0.05
R4049:Ube3b	UTSW	5	114412870	missense	probably benign	0.09
R4096:Ube3b	UTSW	5	114393086	missense	possibly damaging	0.65
R4261:Ube3b	UTSW	5	114398428	missense	possibly damaging	0.80
R4415:Ube3b	UTSW	5	114412444	missense	probably damaging	1.00
R4688:Ube3b	UTSW	5	114393078	missense	probably benign	0.03
R4779:Ube3b	UTSW	5	114404717	splice site	probably null
R4824:Ube3b	UTSW	5	114415726	splice site	probably null
R4868:Ube3b	UTSW	5	114398427	missense	probably benign	0.00
R4953:Ube3b	UTSW	5	114401410	missense	probably benign	0.01
R5013:Ube3b	UTSW	5	114407641	missense	probably damaging	1.00
R5057:Ube3b	UTSW	5	114406257	missense	probably benign	0.01
R5117:Ube3b	UTSW	5	114419631	missense	probably damaging	0.96
R5131:Ube3b	UTSW	5	114407546	missense	probably damaging	1.00
R5498:Ube3b	UTSW	5	114418574	missense	probably damaging	1.00
R5564:Ube3b	UTSW	5	114389075	missense	probably damaging	1.00
R5572:Ube3b	UTSW	5	114406179	missense	probably damaging	0.99
R5580:Ube3b	UTSW	5	114415323	missense	probably benign
R5596:Ube3b	UTSW	5	114406160	splice site	probably null
R5843:Ube3b	UTSW	5	114412299	missense	probably damaging	1.00
R5910:Ube3b	UTSW	5	114415309	missense	possibly damaging	0.63
R6591:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R6691:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R7148:Ube3b	UTSW	5	114406252	missense	probably damaging	0.97
R7334:Ube3b	UTSW	5	114415681	missense	possibly damaging	0.64
R7438:Ube3b	UTSW	5	114415284	missense	possibly damaging	0.79
R7438:Ube3b	UTSW	5	114418626	missense	probably damaging	1.00
R7640:Ube3b	UTSW	5	114415323	missense	probably benign
R7825:Ube3b	UTSW	5	114401312	missense	probably damaging	1.00
R7958:Ube3b	UTSW	5	114401423	missense	probably benign	0.05
R8025:Ube3b	UTSW	5	114408209	missense	probably damaging	0.99
R8058:Ube3b	UTSW	5	114406785	missense	possibly damaging	0.58
R8182:Ube3b	UTSW	5	114392138	missense	possibly damaging	0.77
R8322:Ube3b	UTSW	5	114402686	missense	probably benign	0.04
R8465:Ube3b	UTSW	5	114390390	missense	probably damaging	1.00
X0017:Ube3b	UTSW	5	114415585	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- CTTCTACAGCTCCGTGGATG -3'
(R):5'- ACCCTTGTCCAAACATTTGC -3'

Sequencing Primer
(F):5'- TCCATCAAGGTTAGTGCTGAC -3'
(R):5'- AACATTTGCACTGAGGCTGC -3'

Posted On

2020-06-30