Incidental Mutation 'R8087:E330009J07Rik'
ID629706
Institutional Source Beutler Lab
Gene Symbol E330009J07Rik
Ensembl Gene ENSMUSG00000037172
Gene NameRIKEN cDNA E330009J07 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R8087 (G1)
Quality Score169.009
Status Not validated
Chromosome6
Chromosomal Location40401375-40436135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40418592 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 194 (D194V)
Ref Sequence ENSEMBL: ENSMUSP00000099031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039008] [ENSMUST00000101492] [ENSMUST00000201712]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039008
AA Change: D194V

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045103
Gene: ENSMUSG00000037172
AA Change: D194V

DomainStartEndE-ValueType
low complexity region 30 60 N/A INTRINSIC
Pfam:DUF2347 80 347 3.4e-79 PFAM
Pfam:SPA 234 345 5.2e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101492
AA Change: D194V

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099031
Gene: ENSMUSG00000037172
AA Change: D194V

DomainStartEndE-ValueType
low complexity region 30 60 N/A INTRINSIC
Pfam:DUF2347 80 347 3.2e-78 PFAM
Pfam:SPA 234 345 6.3e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201712
AA Change: D122V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143916
Gene: ENSMUSG00000037172
AA Change: D122V

DomainStartEndE-ValueType
Pfam:DUF2347 15 133 1.4e-29 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.7%
  • 20x: 83.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik G T 14: 32,785,969 probably benign Het
4930451I11Rik A G 7: 126,830,880 V73A possibly damaging Het
A830010M20Rik T A 5: 107,485,087 Y264N probably damaging Het
Abcg1 T C 17: 31,064,485 L48P probably benign Het
Ablim1 A G 19: 57,182,256 W18R Het
Acss1 A G 2: 150,642,748 F192L probably damaging Het
Arhgap32 A G 9: 32,257,028 N769S probably benign Het
BC004004 T A 17: 29,294,090 L163I probably damaging Het
Bco1 A T 8: 117,108,762 T151S possibly damaging Het
C1ra G A 6: 124,513,872 V75I probably damaging Het
Cadps A C 14: 12,536,380 W527G probably damaging Het
Calca T C 7: 114,632,574 N85D probably benign Het
Capn13 A G 17: 73,316,284 L644P probably damaging Het
Ccdc57 T C 11: 120,897,879 I381V probably benign Het
Ccr1 A G 9: 123,964,334 V53A probably benign Het
Cd27 G T 6: 125,233,362 A234D possibly damaging Het
Cnpy4 T A 5: 138,190,270 V46E probably damaging Het
Cspp1 T G 1: 10,104,264 D647E possibly damaging Het
Ctnnd1 A T 2: 84,610,876 F660I possibly damaging Het
Dchs1 A T 7: 105,753,499 S3279T probably benign Het
Ddx11 T A 17: 66,149,993 Y772N probably damaging Het
Dgkd T A 1: 87,916,847 V245E probably damaging Het
Dmgdh C T 13: 93,703,871 T270I possibly damaging Het
Elac2 A G 11: 64,979,208 H33R probably benign Het
Emilin1 T A 5: 30,917,100 D228E probably damaging Het
F2rl1 A G 13: 95,513,999 L125P probably damaging Het
Fam186a A G 15: 99,941,844 V2173A possibly damaging Het
Foxp4 C A 17: 47,904,430 G30C probably damaging Het
Fyn T A 10: 39,529,557 L273* probably null Het
Garnl3 G T 2: 33,045,536 D196E probably benign Het
Glb1 A T 9: 114,430,415 T220S probably damaging Het
Gm9268 A T 7: 43,047,670 Y717F probably benign Het
Hsdl2 G T 4: 59,592,228 A31S unknown Het
Irak3 T A 10: 120,182,535 I103F probably benign Het
Khdrbs2 A T 1: 32,414,976 M148L probably benign Het
Kif2c A T 4: 117,165,418 S500R possibly damaging Het
Kmt2c T C 5: 25,329,252 Y1500C probably damaging Het
Lrp2 T C 2: 69,448,129 D3960G probably damaging Het
Map2k6 A T 11: 110,490,176 I39L probably benign Het
Muc13 G T 16: 33,799,027 Q48H unknown Het
Nlrp1b A T 11: 71,172,071 I721N probably benign Het
Ntsr1 A T 2: 180,500,172 probably benign Het
Nubp1 T C 16: 10,420,348 probably null Het
Olfr92 T C 17: 37,111,548 I145V probably benign Het
Ovol3 A C 7: 30,234,372 D108E probably damaging Het
Pcdhb4 C A 18: 37,308,664 N342K probably damaging Het
Pcgf3 A G 5: 108,486,236 D120G probably benign Het
Pde6b T C 5: 108,388,462 V8A probably benign Het
Pkhd1 G T 1: 20,523,089 T1600K probably damaging Het
Pkp3 A G 7: 141,087,638 I451V possibly damaging Het
Plce1 A G 19: 38,736,521 T1439A probably damaging Het
Prr27 C A 5: 87,846,309 N347K probably benign Het
Prss41 T C 17: 23,837,102 Y259C probably damaging Het
Rasgef1b T C 5: 99,221,389 I457V probably benign Het
Rspry1 G A 8: 94,654,297 V534M probably benign Het
Rxrb T C 17: 34,035,789 V306A probably benign Het
Sim1 T C 10: 50,909,555 M240T possibly damaging Het
Slc22a4 A T 11: 53,996,061 I285K possibly damaging Het
Slc4a2 GGCAGCAGCAGCAGCAGCA GGCAGCAGCAGCAGCA 5: 24,438,749 probably benign Het
Snx19 T C 9: 30,464,402 M993T probably benign Het
Sstr2 G A 11: 113,624,675 R140H probably damaging Het
Syne1 C T 10: 5,333,034 R1553Q probably benign Het
Tchp T C 5: 114,719,604 I386T probably damaging Het
Traf7 G T 17: 24,512,064 S304R possibly damaging Het
Trcg1 C T 9: 57,248,674 L798F probably damaging Het
Ttc3 C T 16: 94,442,953 P1272L probably benign Het
Ttf2 G T 3: 100,964,096 A83E probably damaging Het
Uba3 T A 6: 97,185,383 I421F possibly damaging Het
Ube3b T C 5: 114,412,489 probably null Het
Ulk4 A G 9: 121,266,251 L112P probably damaging Het
Unc5a A G 13: 54,996,172 N150S probably damaging Het
Vac14 A T 8: 110,719,900 K760N probably benign Het
Vmn2r113 A T 17: 22,958,737 I832L possibly damaging Het
Xpot T C 10: 121,601,327 I830V probably benign Het
Zfp101 G A 17: 33,381,003 T593I probably benign Het
Zfp54 A C 17: 21,434,998 T585P probably damaging Het
Zfp663 T C 2: 165,353,759 D180G probably benign Het
Other mutations in E330009J07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02813:E330009J07Rik APN 6 40418539 missense probably benign 0.00
IGL03143:E330009J07Rik APN 6 40422894 splice site probably benign
R1812:E330009J07Rik UTSW 6 40409431 missense probably benign 0.02
R1928:E330009J07Rik UTSW 6 40411714 missense probably benign 0.14
R2443:E330009J07Rik UTSW 6 40406776 missense probably damaging 0.99
R3012:E330009J07Rik UTSW 6 40435992 missense probably benign
R6913:E330009J07Rik UTSW 6 40406917 missense possibly damaging 0.91
R7318:E330009J07Rik UTSW 6 40409164 missense possibly damaging 0.72
R7456:E330009J07Rik UTSW 6 40406840 missense probably benign 0.33
R8231:E330009J07Rik UTSW 6 40418612 missense probably benign 0.35
Y4340:E330009J07Rik UTSW 6 40436058 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCATGAGGCTGAAGCATAATTTC -3'
(R):5'- ATTTCAGACCTTGTGTTTGAGC -3'

Sequencing Primer
(F):5'- TGAGGCTGAAGCATAATTTCTTTATC -3'
(R):5'- CTCTAACAGTAATGGAGACTTGAAGG -3'
Posted On2020-06-30