Incidental Mutation 'R8087:Arhgap32'
ID629720
Institutional Source Beutler Lab
Gene Symbol Arhgap32
Ensembl Gene ENSMUSG00000041444
Gene NameRho GTPase activating protein 32
Synonymsp200RhoGAP, Grit, GC-GAP, PX-RICS, 3426406O18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8087 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location32116136-32268446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32257028 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 769 (N769S)
Ref Sequence ENSEMBL: ENSMUSP00000138145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168954] [ENSMUST00000174641] [ENSMUST00000182802]
Predicted Effect probably benign
Transcript: ENSMUST00000168954
AA Change: N769S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128448
Gene: ENSMUSG00000041444
AA Change: N769S

DomainStartEndE-ValueType
RhoGAP 34 215 9.6e-60 SMART
Blast:RhoGAP 232 298 7e-31 BLAST
low complexity region 518 533 N/A INTRINSIC
low complexity region 669 689 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 960 974 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1304 1317 N/A INTRINSIC
low complexity region 1691 1700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174641
AA Change: N1118S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: N1118S

DomainStartEndE-ValueType
Pfam:PX 132 226 5.6e-7 PFAM
SH3 262 320 7.4e-11 SMART
RhoGAP 383 564 9.6e-60 SMART
Blast:RhoGAP 581 647 9e-31 BLAST
low complexity region 867 882 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1262 1275 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1425 1442 N/A INTRINSIC
low complexity region 1653 1666 N/A INTRINSIC
low complexity region 2040 2049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182802
AA Change: N769S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138145
Gene: ENSMUSG00000041444
AA Change: N769S

DomainStartEndE-ValueType
RhoGAP 34 215 9.6e-60 SMART
Blast:RhoGAP 232 298 7e-31 BLAST
low complexity region 518 533 N/A INTRINSIC
low complexity region 669 689 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 960 974 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1304 1317 N/A INTRINSIC
low complexity region 1691 1700 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.7%
  • 20x: 83.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik G T 14: 32,785,969 probably benign Het
4930451I11Rik A G 7: 126,830,880 V73A possibly damaging Het
A830010M20Rik T A 5: 107,485,087 Y264N probably damaging Het
Abcg1 T C 17: 31,064,485 L48P probably benign Het
Ablim1 A G 19: 57,182,256 W18R Het
Acss1 A G 2: 150,642,748 F192L probably damaging Het
BC004004 T A 17: 29,294,090 L163I probably damaging Het
Bco1 A T 8: 117,108,762 T151S possibly damaging Het
C1ra G A 6: 124,513,872 V75I probably damaging Het
Cadps A C 14: 12,536,380 W527G probably damaging Het
Calca T C 7: 114,632,574 N85D probably benign Het
Capn13 A G 17: 73,316,284 L644P probably damaging Het
Ccdc57 T C 11: 120,897,879 I381V probably benign Het
Ccr1 A G 9: 123,964,334 V53A probably benign Het
Cd27 G T 6: 125,233,362 A234D possibly damaging Het
Cnpy4 T A 5: 138,190,270 V46E probably damaging Het
Cspp1 T G 1: 10,104,264 D647E possibly damaging Het
Ctnnd1 A T 2: 84,610,876 F660I possibly damaging Het
Dchs1 A T 7: 105,753,499 S3279T probably benign Het
Ddx11 T A 17: 66,149,993 Y772N probably damaging Het
Dgkd T A 1: 87,916,847 V245E probably damaging Het
Dmgdh C T 13: 93,703,871 T270I possibly damaging Het
E330009J07Rik T A 6: 40,418,592 D194V possibly damaging Het
Elac2 A G 11: 64,979,208 H33R probably benign Het
Emilin1 T A 5: 30,917,100 D228E probably damaging Het
F2rl1 A G 13: 95,513,999 L125P probably damaging Het
Fam186a A G 15: 99,941,844 V2173A possibly damaging Het
Foxp4 C A 17: 47,904,430 G30C probably damaging Het
Fyn T A 10: 39,529,557 L273* probably null Het
Garnl3 G T 2: 33,045,536 D196E probably benign Het
Glb1 A T 9: 114,430,415 T220S probably damaging Het
Gm9268 A T 7: 43,047,670 Y717F probably benign Het
Hsdl2 G T 4: 59,592,228 A31S unknown Het
Irak3 T A 10: 120,182,535 I103F probably benign Het
Khdrbs2 A T 1: 32,414,976 M148L probably benign Het
Kif2c A T 4: 117,165,418 S500R possibly damaging Het
Kmt2c T C 5: 25,329,252 Y1500C probably damaging Het
Lrp2 T C 2: 69,448,129 D3960G probably damaging Het
Map2k6 A T 11: 110,490,176 I39L probably benign Het
Muc13 G T 16: 33,799,027 Q48H unknown Het
Nlrp1b A T 11: 71,172,071 I721N probably benign Het
Ntsr1 A T 2: 180,500,172 probably benign Het
Nubp1 T C 16: 10,420,348 probably null Het
Olfr92 T C 17: 37,111,548 I145V probably benign Het
Ovol3 A C 7: 30,234,372 D108E probably damaging Het
Pcdhb4 C A 18: 37,308,664 N342K probably damaging Het
Pcgf3 A G 5: 108,486,236 D120G probably benign Het
Pde6b T C 5: 108,388,462 V8A probably benign Het
Pkhd1 G T 1: 20,523,089 T1600K probably damaging Het
Pkp3 A G 7: 141,087,638 I451V possibly damaging Het
Plce1 A G 19: 38,736,521 T1439A probably damaging Het
Prr27 C A 5: 87,846,309 N347K probably benign Het
Prss41 T C 17: 23,837,102 Y259C probably damaging Het
Rasgef1b T C 5: 99,221,389 I457V probably benign Het
Rspry1 G A 8: 94,654,297 V534M probably benign Het
Rxrb T C 17: 34,035,789 V306A probably benign Het
Sim1 T C 10: 50,909,555 M240T possibly damaging Het
Slc22a4 A T 11: 53,996,061 I285K possibly damaging Het
Slc4a2 GGCAGCAGCAGCAGCAGCA GGCAGCAGCAGCAGCA 5: 24,438,749 probably benign Het
Snx19 T C 9: 30,464,402 M993T probably benign Het
Sstr2 G A 11: 113,624,675 R140H probably damaging Het
Syne1 C T 10: 5,333,034 R1553Q probably benign Het
Tchp T C 5: 114,719,604 I386T probably damaging Het
Traf7 G T 17: 24,512,064 S304R possibly damaging Het
Trcg1 C T 9: 57,248,674 L798F probably damaging Het
Ttc3 C T 16: 94,442,953 P1272L probably benign Het
Ttf2 G T 3: 100,964,096 A83E probably damaging Het
Uba3 T A 6: 97,185,383 I421F possibly damaging Het
Ube3b T C 5: 114,412,489 probably null Het
Ulk4 A G 9: 121,266,251 L112P probably damaging Het
Unc5a A G 13: 54,996,172 N150S probably damaging Het
Vac14 A T 8: 110,719,900 K760N probably benign Het
Vmn2r113 A T 17: 22,958,737 I832L possibly damaging Het
Xpot T C 10: 121,601,327 I830V probably benign Het
Zfp101 G A 17: 33,381,003 T593I probably benign Het
Zfp54 A C 17: 21,434,998 T585P probably damaging Het
Zfp663 T C 2: 165,353,759 D180G probably benign Het
Other mutations in Arhgap32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgap32 APN 9 32257361 missense probably benign 0.00
IGL01317:Arhgap32 APN 9 32256964 missense probably benign 0.30
IGL01614:Arhgap32 APN 9 32260505 missense probably damaging 1.00
IGL01791:Arhgap32 APN 9 32247190 missense probably damaging 0.96
IGL02318:Arhgap32 APN 9 32259331 missense probably benign 0.00
IGL02542:Arhgap32 APN 9 32255648 missense probably damaging 1.00
IGL02568:Arhgap32 APN 9 32247194 missense probably damaging 1.00
IGL02627:Arhgap32 APN 9 32246006 missense probably damaging 1.00
IGL02927:Arhgap32 APN 9 32261135 missense possibly damaging 0.95
IGL03157:Arhgap32 APN 9 32259134 missense probably damaging 1.00
IGL03286:Arhgap32 APN 9 32259520 missense probably benign 0.06
PIT4445001:Arhgap32 UTSW 9 32260856 missense probably damaging 1.00
R0004:Arhgap32 UTSW 9 32151998 missense probably damaging 0.98
R0335:Arhgap32 UTSW 9 32259760 missense probably benign 0.00
R0380:Arhgap32 UTSW 9 32246477 missense probably damaging 1.00
R0396:Arhgap32 UTSW 9 32245255 critical splice donor site probably null
R0494:Arhgap32 UTSW 9 32258903 missense probably damaging 0.98
R0508:Arhgap32 UTSW 9 32190068 splice site probably benign
R0856:Arhgap32 UTSW 9 32260220 missense probably damaging 1.00
R0990:Arhgap32 UTSW 9 32255381 missense probably damaging 1.00
R1312:Arhgap32 UTSW 9 32255312 missense probably benign
R1455:Arhgap32 UTSW 9 32260085 missense probably benign 0.08
R1515:Arhgap32 UTSW 9 32116202 missense probably benign
R1523:Arhgap32 UTSW 9 32256752 missense probably damaging 1.00
R1651:Arhgap32 UTSW 9 32259800 missense probably damaging 1.00
R1743:Arhgap32 UTSW 9 32259431 missense probably benign 0.00
R1999:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2098:Arhgap32 UTSW 9 32259911 missense probably damaging 1.00
R2150:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2256:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2257:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2989:Arhgap32 UTSW 9 32239398 missense possibly damaging 0.54
R3780:Arhgap32 UTSW 9 32152019 splice site probably null
R3793:Arhgap32 UTSW 9 32255373 missense probably damaging 1.00
R3846:Arhgap32 UTSW 9 32190024 missense probably benign 0.03
R4086:Arhgap32 UTSW 9 32247066 unclassified probably benign
R4177:Arhgap32 UTSW 9 32247214 missense probably null 1.00
R4230:Arhgap32 UTSW 9 32257474 missense probably benign 0.10
R4280:Arhgap32 UTSW 9 32259889 missense probably damaging 0.98
R4504:Arhgap32 UTSW 9 32181839 splice site probably null
R4587:Arhgap32 UTSW 9 32260945 missense probably benign 0.02
R4612:Arhgap32 UTSW 9 32259479 missense probably damaging 0.99
R4622:Arhgap32 UTSW 9 32239348 missense possibly damaging 0.75
R4670:Arhgap32 UTSW 9 32170145 missense probably benign 0.03
R4784:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4784:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4785:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4785:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4906:Arhgap32 UTSW 9 32245256 critical splice donor site probably null
R5046:Arhgap32 UTSW 9 32256799 missense probably damaging 1.00
R5360:Arhgap32 UTSW 9 32259671 missense probably damaging 1.00
R5382:Arhgap32 UTSW 9 32152010 missense probably damaging 1.00
R5445:Arhgap32 UTSW 9 32248382 missense probably benign 0.19
R5637:Arhgap32 UTSW 9 32247206 missense probably damaging 1.00
R5659:Arhgap32 UTSW 9 32181960 missense probably damaging 1.00
R5801:Arhgap32 UTSW 9 32255788 missense probably benign 0.01
R6002:Arhgap32 UTSW 9 32256979 missense probably benign 0.00
R6109:Arhgap32 UTSW 9 32260111 missense probably damaging 1.00
R6405:Arhgap32 UTSW 9 32248488 missense probably benign 0.31
R6922:Arhgap32 UTSW 9 32152687 missense possibly damaging 0.86
R7009:Arhgap32 UTSW 9 32245976 missense probably damaging 1.00
R7137:Arhgap32 UTSW 9 32151936 missense probably benign 0.32
R7183:Arhgap32 UTSW 9 32186383 missense probably benign 0.15
R7251:Arhgap32 UTSW 9 32208185 missense probably damaging 1.00
R7287:Arhgap32 UTSW 9 32152697 missense
R7289:Arhgap32 UTSW 9 32256937 missense possibly damaging 0.92
R7289:Arhgap32 UTSW 9 32256938 missense probably benign 0.02
R7391:Arhgap32 UTSW 9 32181939 missense probably benign 0.00
R7408:Arhgap32 UTSW 9 32245924 missense probably benign 0.06
R7566:Arhgap32 UTSW 9 32250722 missense probably benign 0.10
R7584:Arhgap32 UTSW 9 32256967 missense probably benign 0.16
R7653:Arhgap32 UTSW 9 32257145 missense probably benign
R7884:Arhgap32 UTSW 9 32260514 missense possibly damaging 0.87
R8109:Arhgap32 UTSW 9 32181854 missense probably benign 0.09
R8131:Arhgap32 UTSW 9 32247130 missense probably damaging 1.00
R8155:Arhgap32 UTSW 9 32181900 missense probably damaging 1.00
R8232:Arhgap32 UTSW 9 32256902 missense probably damaging 1.00
R8303:Arhgap32 UTSW 9 32260909 missense probably benign 0.00
R8304:Arhgap32 UTSW 9 32255937 nonsense probably null
X0027:Arhgap32 UTSW 9 32250641 critical splice acceptor site probably null
X0063:Arhgap32 UTSW 9 32261069 missense probably damaging 1.00
Z1177:Arhgap32 UTSW 9 32260680 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AATGTCGCCCGAATGTTGGC -3'
(R):5'- AAGGGAGCTGAAGTGCTTC -3'

Sequencing Primer
(F):5'- CGTTAGCTGAGTCTGCACAG -3'
(R):5'- AGCTGAAGTGCTTCTAGCC -3'
Posted On2020-06-30