Incidental Mutation 'R8087:Ulk4'
ID 629723
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Name unc-51-like kinase 4
Synonyms 4932415A06Rik
MMRRC Submission 067520-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.682) question?
Stock # R8087 (G1)
Quality Score 194.009
Status Not validated
Chromosome 9
Chromosomal Location 120793520-121115225 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121095317 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 112 (L112P)
Ref Sequence ENSEMBL: ENSMUSP00000057960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000171061] [ENSMUST00000171923]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000051479
AA Change: L112P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: L112P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000171061
AA Change: L112P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936
AA Change: L112P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171923
AA Change: L112P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: L112P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.7%
  • 20x: 83.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik A G 7: 126,430,052 (GRCm39) V73A possibly damaging Het
Abcg1 T C 17: 31,283,459 (GRCm39) L48P probably benign Het
Ablim1 A G 19: 57,170,688 (GRCm39) W18R Het
Acss1 A G 2: 150,484,668 (GRCm39) F192L probably damaging Het
Arhgap32 A G 9: 32,168,324 (GRCm39) N769S probably benign Het
BC004004 T A 17: 29,513,064 (GRCm39) L163I probably damaging Het
Bco1 A T 8: 117,835,501 (GRCm39) T151S possibly damaging Het
Btbd8 T A 5: 107,632,953 (GRCm39) Y264N probably damaging Het
C1ra G A 6: 124,490,831 (GRCm39) V75I probably damaging Het
Cadps A C 14: 12,536,380 (GRCm38) W527G probably damaging Het
Calca T C 7: 114,231,809 (GRCm39) N85D probably benign Het
Capn13 A G 17: 73,623,279 (GRCm39) L644P probably damaging Het
Ccdc57 T C 11: 120,788,705 (GRCm39) I381V probably benign Het
Ccr1 A G 9: 123,764,371 (GRCm39) V53A probably benign Het
Cd27 G T 6: 125,210,325 (GRCm39) A234D possibly damaging Het
Cnpy4 T A 5: 138,188,532 (GRCm39) V46E probably damaging Het
Cspp1 T G 1: 10,174,489 (GRCm39) D647E possibly damaging Het
Ctnnd1 A T 2: 84,441,220 (GRCm39) F660I possibly damaging Het
Dchs1 A T 7: 105,402,706 (GRCm39) S3279T probably benign Het
Ddx11 T A 17: 66,456,988 (GRCm39) Y772N probably damaging Het
Dennd11 T A 6: 40,395,526 (GRCm39) D194V possibly damaging Het
Dgkd T A 1: 87,844,569 (GRCm39) V245E probably damaging Het
Dmgdh C T 13: 93,840,379 (GRCm39) T270I possibly damaging Het
Elac2 A G 11: 64,870,034 (GRCm39) H33R probably benign Het
Emilin1 T A 5: 31,074,444 (GRCm39) D228E probably damaging Het
F2rl1 A G 13: 95,650,507 (GRCm39) L125P probably damaging Het
Fam186a A G 15: 99,839,725 (GRCm39) V2173A possibly damaging Het
Foxp4 C A 17: 48,215,355 (GRCm39) G30C probably damaging Het
Fyn T A 10: 39,405,553 (GRCm39) L273* probably null Het
Garnl3 G T 2: 32,935,548 (GRCm39) D196E probably benign Het
Glb1 A T 9: 114,259,483 (GRCm39) T220S probably damaging Het
Hsdl2 G T 4: 59,592,228 (GRCm39) A31S unknown Het
Irak3 T A 10: 120,018,440 (GRCm39) I103F probably benign Het
Khdrbs2 A T 1: 32,454,057 (GRCm39) M148L probably benign Het
Kif2c A T 4: 117,022,615 (GRCm39) S500R possibly damaging Het
Kmt2c T C 5: 25,534,250 (GRCm39) Y1500C probably damaging Het
Lrp2 T C 2: 69,278,473 (GRCm39) D3960G probably damaging Het
Map2k6 A T 11: 110,381,002 (GRCm39) I39L probably benign Het
Muc13 G T 16: 33,619,397 (GRCm39) Q48H unknown Het
Nlrp1b A T 11: 71,062,897 (GRCm39) I721N probably benign Het
Ntsr1 A T 2: 180,141,965 (GRCm39) probably benign Het
Nubp1 T C 16: 10,238,212 (GRCm39) probably null Het
Or2h2c T C 17: 37,422,440 (GRCm39) I145V probably benign Het
Ovol3 A C 7: 29,933,797 (GRCm39) D108E probably damaging Het
Pcdhb4 C A 18: 37,441,717 (GRCm39) N342K probably damaging Het
Pcgf3 A G 5: 108,634,102 (GRCm39) D120G probably benign Het
Pde6b T C 5: 108,536,328 (GRCm39) V8A probably benign Het
Pkhd1 G T 1: 20,593,313 (GRCm39) T1600K probably damaging Het
Pkp3 A G 7: 140,667,551 (GRCm39) I451V possibly damaging Het
Plce1 A G 19: 38,724,965 (GRCm39) T1439A probably damaging Het
Prr27 C A 5: 87,994,168 (GRCm39) N347K probably benign Het
Prss41 T C 17: 24,056,076 (GRCm39) Y259C probably damaging Het
Rasgef1b T C 5: 99,369,248 (GRCm39) I457V probably benign Het
Rspry1 G A 8: 95,380,925 (GRCm39) V534M probably benign Het
Rxrb T C 17: 34,254,763 (GRCm39) V306A probably benign Het
Sim1 T C 10: 50,785,651 (GRCm39) M240T possibly damaging Het
Slc22a4 A T 11: 53,886,887 (GRCm39) I285K possibly damaging Het
Slc4a2 GGCAGCAGCAGCAGCAGCA GGCAGCAGCAGCAGCA 5: 24,643,747 (GRCm39) probably benign Het
Snx19 T C 9: 30,375,698 (GRCm39) M993T probably benign Het
Sstr2 G A 11: 113,515,501 (GRCm39) R140H probably damaging Het
Syne1 C T 10: 5,283,034 (GRCm39) R1553Q probably benign Het
Tchp T C 5: 114,857,665 (GRCm39) I386T probably damaging Het
Tmem273 G T 14: 32,507,926 (GRCm39) probably benign Het
Traf7 G T 17: 24,731,038 (GRCm39) S304R possibly damaging Het
Trcg1 C T 9: 57,155,957 (GRCm39) L798F probably damaging Het
Ttc3 C T 16: 94,243,812 (GRCm39) P1272L probably benign Het
Ttf2 G T 3: 100,871,412 (GRCm39) A83E probably damaging Het
Uba3 T A 6: 97,162,344 (GRCm39) I421F possibly damaging Het
Ube3b T C 5: 114,550,550 (GRCm39) probably null Het
Unc5a A G 13: 55,143,985 (GRCm39) N150S probably damaging Het
Vac14 A T 8: 111,446,532 (GRCm39) K760N probably benign Het
Vmn2r113 A T 17: 23,177,711 (GRCm39) I832L possibly damaging Het
Vmn2r-ps158 A T 7: 42,697,094 (GRCm39) Y717F probably benign Het
Xpot T C 10: 121,437,232 (GRCm39) I830V probably benign Het
Zfp101 G A 17: 33,599,977 (GRCm39) T593I probably benign Het
Zfp54 A C 17: 21,655,260 (GRCm39) T585P probably damaging Het
Zfp663 T C 2: 165,195,679 (GRCm39) D180G probably benign Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 120,997,358 (GRCm39) missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121,037,228 (GRCm39) missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121,095,367 (GRCm39) missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121,084,251 (GRCm39) missense probably damaging 1.00
IGL02139:Ulk4 APN 9 120,970,897 (GRCm39) splice site probably null
IGL02266:Ulk4 APN 9 120,910,766 (GRCm39) missense probably benign 0.10
IGL02511:Ulk4 APN 9 121,017,420 (GRCm39) missense probably damaging 1.00
IGL02546:Ulk4 APN 9 120,981,373 (GRCm39) nonsense probably null
IGL02687:Ulk4 APN 9 121,021,728 (GRCm39) missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 120,974,402 (GRCm39) missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121,084,237 (GRCm39) missense probably benign 0.02
R0031:Ulk4 UTSW 9 121,102,048 (GRCm39) missense probably damaging 1.00
R0433:Ulk4 UTSW 9 120,873,885 (GRCm39) missense probably benign 0.27
R0513:Ulk4 UTSW 9 120,981,391 (GRCm39) missense probably benign 0.13
R0524:Ulk4 UTSW 9 121,081,717 (GRCm39) critical splice donor site probably null
R1268:Ulk4 UTSW 9 121,086,140 (GRCm39) splice site probably benign
R1439:Ulk4 UTSW 9 121,095,324 (GRCm39) missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1531:Ulk4 UTSW 9 120,873,841 (GRCm39) missense probably damaging 0.97
R1595:Ulk4 UTSW 9 120,873,904 (GRCm39) missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121,033,871 (GRCm39) missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 120,997,250 (GRCm39) missense probably null 1.00
R1966:Ulk4 UTSW 9 121,086,182 (GRCm39) missense probably benign
R2129:Ulk4 UTSW 9 120,981,248 (GRCm39) missense probably benign 0.03
R2329:Ulk4 UTSW 9 121,101,953 (GRCm39) missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R2878:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R3734:Ulk4 UTSW 9 121,091,055 (GRCm39) missense probably benign 0.21
R3769:Ulk4 UTSW 9 121,092,766 (GRCm39) missense probably benign 0.00
R4005:Ulk4 UTSW 9 120,997,265 (GRCm39) missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 120,873,915 (GRCm39) missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 120,903,062 (GRCm39) missense probably benign 0.00
R4461:Ulk4 UTSW 9 120,985,950 (GRCm39) missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4542:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4572:Ulk4 UTSW 9 121,021,830 (GRCm39) missense probably damaging 1.00
R4647:Ulk4 UTSW 9 120,970,918 (GRCm39) missense probably benign 0.15
R4712:Ulk4 UTSW 9 121,073,436 (GRCm39) missense probably benign 0.23
R4730:Ulk4 UTSW 9 121,092,791 (GRCm39) missense probably benign 0.05
R4731:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4732:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4733:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4737:Ulk4 UTSW 9 120,902,938 (GRCm39) nonsense probably null
R4781:Ulk4 UTSW 9 120,932,642 (GRCm39) missense probably benign 0.00
R4860:Ulk4 UTSW 9 121,079,968 (GRCm39) missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121,087,798 (GRCm39) missense probably benign 0.00
R4990:Ulk4 UTSW 9 121,021,852 (GRCm39) missense probably benign 0.01
R6056:Ulk4 UTSW 9 121,102,021 (GRCm39) missense probably damaging 1.00
R6448:Ulk4 UTSW 9 120,932,696 (GRCm39) missense probably damaging 0.99
R6546:Ulk4 UTSW 9 120,970,960 (GRCm39) missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121,017,408 (GRCm39) missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121,087,886 (GRCm39) missense probably benign
R6929:Ulk4 UTSW 9 120,903,081 (GRCm39) missense probably benign 0.02
R7069:Ulk4 UTSW 9 121,095,583 (GRCm39) missense probably benign 0.25
R7069:Ulk4 UTSW 9 121,087,876 (GRCm39) missense probably benign 0.01
R7293:Ulk4 UTSW 9 121,084,190 (GRCm39) missense probably damaging 1.00
R7299:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7301:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7337:Ulk4 UTSW 9 121,077,993 (GRCm39) missense probably benign 0.44
R7395:Ulk4 UTSW 9 121,084,178 (GRCm39) missense probably benign
R7423:Ulk4 UTSW 9 120,932,687 (GRCm39) missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 120,970,904 (GRCm39) missense probably benign 0.00
R7753:Ulk4 UTSW 9 121,095,578 (GRCm39) critical splice donor site probably null
R7790:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 120,873,885 (GRCm39) missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121,102,022 (GRCm39) missense probably damaging 1.00
R8203:Ulk4 UTSW 9 120,997,274 (GRCm39) missense probably damaging 0.96
R8246:Ulk4 UTSW 9 120,985,941 (GRCm39) makesense probably null
R8430:Ulk4 UTSW 9 121,086,144 (GRCm39) critical splice donor site probably null
R8841:Ulk4 UTSW 9 121,033,804 (GRCm39) missense probably damaging 1.00
R9014:Ulk4 UTSW 9 121,017,294 (GRCm39) missense probably benign 0.00
R9092:Ulk4 UTSW 9 120,903,003 (GRCm39) missense
R9126:Ulk4 UTSW 9 121,090,988 (GRCm39) missense probably damaging 0.99
R9176:Ulk4 UTSW 9 120,974,128 (GRCm39) missense probably benign
R9235:Ulk4 UTSW 9 120,981,217 (GRCm39) missense probably benign 0.13
R9713:Ulk4 UTSW 9 120,873,862 (GRCm39) nonsense probably null
X0024:Ulk4 UTSW 9 121,021,819 (GRCm39) missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121,091,672 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACAGCTTACATATATGACAGC -3'
(R):5'- GTGAGTGTGTGCATGCAGAC -3'

Sequencing Primer
(F):5'- CCCTGAGAAAGTCTTCAGG -3'
(R):5'- TGTGCATGCAGACACGGG -3'
Posted On 2020-06-30