Incidental Mutation 'R8087:F2rl1'
ID 629738
Institutional Source Beutler Lab
Gene Symbol F2rl1
Ensembl Gene ENSMUSG00000021678
Gene Name F2R like trypsin receptor 1
Synonyms Protease-activated receptor-2, coagulation factor II (thrombin) receptor-like 1, Par2, Gpcr11, proteinase-activated receptor-2, PAR-2
MMRRC Submission 067520-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8087 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 95648240-95661735 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 95650507 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 125 (L125P)
Ref Sequence ENSEMBL: ENSMUSP00000022185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022185]
AlphaFold P55086
Predicted Effect probably damaging
Transcript: ENSMUST00000022185
AA Change: L125P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022185
Gene: ENSMUSG00000021678
AA Change: L125P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:7TM_GPCR_Srv 75 363 3.8e-12 PFAM
Pfam:7TM_GPCR_Srw 82 364 1.2e-10 PFAM
Pfam:7tm_1 94 346 1.5e-42 PFAM
low complexity region 375 398 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.7%
  • 20x: 83.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor 1 family of proteins. The encoded cell surface receptor is activated through proteolytic cleavage of its extracellular amino terminus, resulting in a new amino terminus that acts as a tethered ligand that binds to an extracellular loop domain. Activation of the receptor has been shown to stimulate vascular smooth muscle relaxation, dilate blood vessels, increase blood flow, and lower blood pressure. This protein is also important in the inflammatory response, as well as innate and adaptive immunity. [provided by RefSeq, Jun 2016]
PHENOTYPE: Nullizygous mice may exhibit impaired leukocyte rolling and dendritic cell maturation, altered inflammatory response in various models of acute and chronic inflammatory disease, altered susceptibility to injury and to autoimmune disorders, and abnormal hemodynamic responses and pain thresholds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik A G 7: 126,430,052 (GRCm39) V73A possibly damaging Het
Abcg1 T C 17: 31,283,459 (GRCm39) L48P probably benign Het
Ablim1 A G 19: 57,170,688 (GRCm39) W18R Het
Acss1 A G 2: 150,484,668 (GRCm39) F192L probably damaging Het
Arhgap32 A G 9: 32,168,324 (GRCm39) N769S probably benign Het
BC004004 T A 17: 29,513,064 (GRCm39) L163I probably damaging Het
Bco1 A T 8: 117,835,501 (GRCm39) T151S possibly damaging Het
Btbd8 T A 5: 107,632,953 (GRCm39) Y264N probably damaging Het
C1ra G A 6: 124,490,831 (GRCm39) V75I probably damaging Het
Cadps A C 14: 12,536,380 (GRCm38) W527G probably damaging Het
Calca T C 7: 114,231,809 (GRCm39) N85D probably benign Het
Capn13 A G 17: 73,623,279 (GRCm39) L644P probably damaging Het
Ccdc57 T C 11: 120,788,705 (GRCm39) I381V probably benign Het
Ccr1 A G 9: 123,764,371 (GRCm39) V53A probably benign Het
Cd27 G T 6: 125,210,325 (GRCm39) A234D possibly damaging Het
Cnpy4 T A 5: 138,188,532 (GRCm39) V46E probably damaging Het
Cspp1 T G 1: 10,174,489 (GRCm39) D647E possibly damaging Het
Ctnnd1 A T 2: 84,441,220 (GRCm39) F660I possibly damaging Het
Dchs1 A T 7: 105,402,706 (GRCm39) S3279T probably benign Het
Ddx11 T A 17: 66,456,988 (GRCm39) Y772N probably damaging Het
Dennd11 T A 6: 40,395,526 (GRCm39) D194V possibly damaging Het
Dgkd T A 1: 87,844,569 (GRCm39) V245E probably damaging Het
Dmgdh C T 13: 93,840,379 (GRCm39) T270I possibly damaging Het
Elac2 A G 11: 64,870,034 (GRCm39) H33R probably benign Het
Emilin1 T A 5: 31,074,444 (GRCm39) D228E probably damaging Het
Fam186a A G 15: 99,839,725 (GRCm39) V2173A possibly damaging Het
Foxp4 C A 17: 48,215,355 (GRCm39) G30C probably damaging Het
Fyn T A 10: 39,405,553 (GRCm39) L273* probably null Het
Garnl3 G T 2: 32,935,548 (GRCm39) D196E probably benign Het
Glb1 A T 9: 114,259,483 (GRCm39) T220S probably damaging Het
Hsdl2 G T 4: 59,592,228 (GRCm39) A31S unknown Het
Irak3 T A 10: 120,018,440 (GRCm39) I103F probably benign Het
Khdrbs2 A T 1: 32,454,057 (GRCm39) M148L probably benign Het
Kif2c A T 4: 117,022,615 (GRCm39) S500R possibly damaging Het
Kmt2c T C 5: 25,534,250 (GRCm39) Y1500C probably damaging Het
Lrp2 T C 2: 69,278,473 (GRCm39) D3960G probably damaging Het
Map2k6 A T 11: 110,381,002 (GRCm39) I39L probably benign Het
Muc13 G T 16: 33,619,397 (GRCm39) Q48H unknown Het
Nlrp1b A T 11: 71,062,897 (GRCm39) I721N probably benign Het
Ntsr1 A T 2: 180,141,965 (GRCm39) probably benign Het
Nubp1 T C 16: 10,238,212 (GRCm39) probably null Het
Or2h2c T C 17: 37,422,440 (GRCm39) I145V probably benign Het
Ovol3 A C 7: 29,933,797 (GRCm39) D108E probably damaging Het
Pcdhb4 C A 18: 37,441,717 (GRCm39) N342K probably damaging Het
Pcgf3 A G 5: 108,634,102 (GRCm39) D120G probably benign Het
Pde6b T C 5: 108,536,328 (GRCm39) V8A probably benign Het
Pkhd1 G T 1: 20,593,313 (GRCm39) T1600K probably damaging Het
Pkp3 A G 7: 140,667,551 (GRCm39) I451V possibly damaging Het
Plce1 A G 19: 38,724,965 (GRCm39) T1439A probably damaging Het
Prr27 C A 5: 87,994,168 (GRCm39) N347K probably benign Het
Prss41 T C 17: 24,056,076 (GRCm39) Y259C probably damaging Het
Rasgef1b T C 5: 99,369,248 (GRCm39) I457V probably benign Het
Rspry1 G A 8: 95,380,925 (GRCm39) V534M probably benign Het
Rxrb T C 17: 34,254,763 (GRCm39) V306A probably benign Het
Sim1 T C 10: 50,785,651 (GRCm39) M240T possibly damaging Het
Slc22a4 A T 11: 53,886,887 (GRCm39) I285K possibly damaging Het
Slc4a2 GGCAGCAGCAGCAGCAGCA GGCAGCAGCAGCAGCA 5: 24,643,747 (GRCm39) probably benign Het
Snx19 T C 9: 30,375,698 (GRCm39) M993T probably benign Het
Sstr2 G A 11: 113,515,501 (GRCm39) R140H probably damaging Het
Syne1 C T 10: 5,283,034 (GRCm39) R1553Q probably benign Het
Tchp T C 5: 114,857,665 (GRCm39) I386T probably damaging Het
Tmem273 G T 14: 32,507,926 (GRCm39) probably benign Het
Traf7 G T 17: 24,731,038 (GRCm39) S304R possibly damaging Het
Trcg1 C T 9: 57,155,957 (GRCm39) L798F probably damaging Het
Ttc3 C T 16: 94,243,812 (GRCm39) P1272L probably benign Het
Ttf2 G T 3: 100,871,412 (GRCm39) A83E probably damaging Het
Uba3 T A 6: 97,162,344 (GRCm39) I421F possibly damaging Het
Ube3b T C 5: 114,550,550 (GRCm39) probably null Het
Ulk4 A G 9: 121,095,317 (GRCm39) L112P probably damaging Het
Unc5a A G 13: 55,143,985 (GRCm39) N150S probably damaging Het
Vac14 A T 8: 111,446,532 (GRCm39) K760N probably benign Het
Vmn2r113 A T 17: 23,177,711 (GRCm39) I832L possibly damaging Het
Vmn2r-ps158 A T 7: 42,697,094 (GRCm39) Y717F probably benign Het
Xpot T C 10: 121,437,232 (GRCm39) I830V probably benign Het
Zfp101 G A 17: 33,599,977 (GRCm39) T593I probably benign Het
Zfp54 A C 17: 21,655,260 (GRCm39) T585P probably damaging Het
Zfp663 T C 2: 165,195,679 (GRCm39) D180G probably benign Het
Other mutations in F2rl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:F2rl1 APN 13 95,650,261 (GRCm39) missense probably benign 0.03
IGL01996:F2rl1 APN 13 95,650,432 (GRCm39) missense probably damaging 1.00
IGL02987:F2rl1 APN 13 95,650,741 (GRCm39) missense probably benign 0.00
IGL03053:F2rl1 APN 13 95,650,126 (GRCm39) missense probably benign 0.03
IGL03290:F2rl1 APN 13 95,650,097 (GRCm39) missense possibly damaging 0.89
PIT4382001:F2rl1 UTSW 13 95,650,154 (GRCm39) missense probably benign 0.00
R2005:F2rl1 UTSW 13 95,649,782 (GRCm39) missense probably damaging 1.00
R3794:F2rl1 UTSW 13 95,649,719 (GRCm39) missense unknown
R4236:F2rl1 UTSW 13 95,649,796 (GRCm39) missense probably damaging 1.00
R4715:F2rl1 UTSW 13 95,649,775 (GRCm39) missense probably damaging 0.99
R4741:F2rl1 UTSW 13 95,650,651 (GRCm39) missense probably damaging 1.00
R4799:F2rl1 UTSW 13 95,650,477 (GRCm39) missense possibly damaging 0.81
R4870:F2rl1 UTSW 13 95,650,492 (GRCm39) missense probably damaging 0.99
R5992:F2rl1 UTSW 13 95,650,778 (GRCm39) missense probably benign 0.01
R6276:F2rl1 UTSW 13 95,650,446 (GRCm39) nonsense probably null
R7568:F2rl1 UTSW 13 95,650,522 (GRCm39) missense probably damaging 1.00
R7761:F2rl1 UTSW 13 95,650,382 (GRCm39) missense probably damaging 1.00
R8281:F2rl1 UTSW 13 95,650,585 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCACGATCACCCAGTACC -3'
(R):5'- CTCCAATCACTGGGAAAGGG -3'

Sequencing Primer
(F):5'- AGTACCTCTGCACGCTGAG -3'
(R):5'- GAACCAGGCTTTTCCATCGATGAG -3'
Posted On 2020-06-30