Incidental Mutation 'R8087:Cadps'
ID629739
Institutional Source Beutler Lab
Gene Symbol Cadps
Ensembl Gene ENSMUSG00000054423
Gene NameCa2+-dependent secretion activator
SynonymsCAPS1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8087 (G1)
Quality Score173.009
Status Not validated
Chromosome14
Chromosomal Location12372563-12823079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 12536380 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 527 (W527G)
Ref Sequence ENSEMBL: ENSMUSP00000064706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067491] [ENSMUST00000112657] [ENSMUST00000112658] [ENSMUST00000177814] [ENSMUST00000224882]
Predicted Effect probably damaging
Transcript: ENSMUST00000067491
AA Change: W527G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064706
Gene: ENSMUSG00000054423
AA Change: W527G

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 772 783 N/A INTRINSIC
DUF1041 833 948 6.21e-54 SMART
low complexity region 1022 1045 N/A INTRINSIC
low complexity region 1354 1361 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112657
AA Change: W527G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108276
Gene: ENSMUSG00000054423
AA Change: W527G

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 775 786 N/A INTRINSIC
DUF1041 836 941 3.88e-55 SMART
low complexity region 1015 1038 N/A INTRINSIC
low complexity region 1347 1354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112658
AA Change: W527G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108277
Gene: ENSMUSG00000054423
AA Change: W527G

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 776 787 N/A INTRINSIC
DUF1041 837 942 3.88e-55 SMART
low complexity region 1016 1039 N/A INTRINSIC
low complexity region 1348 1355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177814
AA Change: W527G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136076
Gene: ENSMUSG00000054423
AA Change: W527G

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 777 788 N/A INTRINSIC
DUF1041 838 943 2.75e-55 SMART
low complexity region 1017 1040 N/A INTRINSIC
low complexity region 1349 1356 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224882
AA Change: W527G

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.7%
  • 20x: 83.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel neural/endocrine-specific cytosolic and peripheral membrane protein required for the Ca2+-regulated exocytosis of secretory vesicles. The protein acts at a stage in exocytosis that follows ATP-dependent priming, which involves the essential synthesis of phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). Alternative splicing has been observed at this locus and three variants, encoding distinct isoforms, are described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, respiratory failure and abnormal adrenal gland physiology. Adult heterozygous null mice display abnormal adrenal gland physiology that is different from that seen in homozygous neonates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik G T 14: 32,785,969 probably benign Het
4930451I11Rik A G 7: 126,830,880 V73A possibly damaging Het
A830010M20Rik T A 5: 107,485,087 Y264N probably damaging Het
Abcg1 T C 17: 31,064,485 L48P probably benign Het
Ablim1 A G 19: 57,182,256 W18R Het
Acss1 A G 2: 150,642,748 F192L probably damaging Het
Arhgap32 A G 9: 32,257,028 N769S probably benign Het
BC004004 T A 17: 29,294,090 L163I probably damaging Het
Bco1 A T 8: 117,108,762 T151S possibly damaging Het
C1ra G A 6: 124,513,872 V75I probably damaging Het
Calca T C 7: 114,632,574 N85D probably benign Het
Capn13 A G 17: 73,316,284 L644P probably damaging Het
Ccdc57 T C 11: 120,897,879 I381V probably benign Het
Ccr1 A G 9: 123,964,334 V53A probably benign Het
Cd27 G T 6: 125,233,362 A234D possibly damaging Het
Cnpy4 T A 5: 138,190,270 V46E probably damaging Het
Cspp1 T G 1: 10,104,264 D647E possibly damaging Het
Ctnnd1 A T 2: 84,610,876 F660I possibly damaging Het
Dchs1 A T 7: 105,753,499 S3279T probably benign Het
Ddx11 T A 17: 66,149,993 Y772N probably damaging Het
Dgkd T A 1: 87,916,847 V245E probably damaging Het
Dmgdh C T 13: 93,703,871 T270I possibly damaging Het
E330009J07Rik T A 6: 40,418,592 D194V possibly damaging Het
Elac2 A G 11: 64,979,208 H33R probably benign Het
Emilin1 T A 5: 30,917,100 D228E probably damaging Het
F2rl1 A G 13: 95,513,999 L125P probably damaging Het
Fam186a A G 15: 99,941,844 V2173A possibly damaging Het
Foxp4 C A 17: 47,904,430 G30C probably damaging Het
Fyn T A 10: 39,529,557 L273* probably null Het
Garnl3 G T 2: 33,045,536 D196E probably benign Het
Glb1 A T 9: 114,430,415 T220S probably damaging Het
Gm9268 A T 7: 43,047,670 Y717F probably benign Het
Hsdl2 G T 4: 59,592,228 A31S unknown Het
Irak3 T A 10: 120,182,535 I103F probably benign Het
Khdrbs2 A T 1: 32,414,976 M148L probably benign Het
Kif2c A T 4: 117,165,418 S500R possibly damaging Het
Kmt2c T C 5: 25,329,252 Y1500C probably damaging Het
Lrp2 T C 2: 69,448,129 D3960G probably damaging Het
Map2k6 A T 11: 110,490,176 I39L probably benign Het
Muc13 G T 16: 33,799,027 Q48H unknown Het
Nlrp1b A T 11: 71,172,071 I721N probably benign Het
Ntsr1 A T 2: 180,500,172 probably benign Het
Nubp1 T C 16: 10,420,348 probably null Het
Olfr92 T C 17: 37,111,548 I145V probably benign Het
Ovol3 A C 7: 30,234,372 D108E probably damaging Het
Pcdhb4 C A 18: 37,308,664 N342K probably damaging Het
Pcgf3 A G 5: 108,486,236 D120G probably benign Het
Pde6b T C 5: 108,388,462 V8A probably benign Het
Pkhd1 G T 1: 20,523,089 T1600K probably damaging Het
Pkp3 A G 7: 141,087,638 I451V possibly damaging Het
Plce1 A G 19: 38,736,521 T1439A probably damaging Het
Prr27 C A 5: 87,846,309 N347K probably benign Het
Prss41 T C 17: 23,837,102 Y259C probably damaging Het
Rasgef1b T C 5: 99,221,389 I457V probably benign Het
Rspry1 G A 8: 94,654,297 V534M probably benign Het
Rxrb T C 17: 34,035,789 V306A probably benign Het
Sim1 T C 10: 50,909,555 M240T possibly damaging Het
Slc22a4 A T 11: 53,996,061 I285K possibly damaging Het
Slc4a2 GGCAGCAGCAGCAGCAGCA GGCAGCAGCAGCAGCA 5: 24,438,749 probably benign Het
Snx19 T C 9: 30,464,402 M993T probably benign Het
Sstr2 G A 11: 113,624,675 R140H probably damaging Het
Syne1 C T 10: 5,333,034 R1553Q probably benign Het
Tchp T C 5: 114,719,604 I386T probably damaging Het
Traf7 G T 17: 24,512,064 S304R possibly damaging Het
Trcg1 C T 9: 57,248,674 L798F probably damaging Het
Ttc3 C T 16: 94,442,953 P1272L probably benign Het
Ttf2 G T 3: 100,964,096 A83E probably damaging Het
Uba3 T A 6: 97,185,383 I421F possibly damaging Het
Ube3b T C 5: 114,412,489 probably null Het
Ulk4 A G 9: 121,266,251 L112P probably damaging Het
Unc5a A G 13: 54,996,172 N150S probably damaging Het
Vac14 A T 8: 110,719,900 K760N probably benign Het
Vmn2r113 A T 17: 22,958,737 I832L possibly damaging Het
Xpot T C 10: 121,601,327 I830V probably benign Het
Zfp101 G A 17: 33,381,003 T593I probably benign Het
Zfp54 A C 17: 21,434,998 T585P probably damaging Het
Zfp663 T C 2: 165,353,759 D180G probably benign Het
Other mutations in Cadps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Cadps APN 14 12491795 missense probably damaging 1.00
IGL00990:Cadps APN 14 12715374 missense possibly damaging 0.56
IGL01071:Cadps APN 14 12509091 splice site probably null
IGL01339:Cadps APN 14 12486543 missense possibly damaging 0.58
IGL01518:Cadps APN 14 12522352 missense probably damaging 1.00
IGL01560:Cadps APN 14 12491792 missense probably damaging 1.00
IGL01598:Cadps APN 14 12522202 critical splice donor site probably null
IGL01603:Cadps APN 14 12454154 splice site probably benign
IGL01836:Cadps APN 14 12522311 missense probably damaging 1.00
IGL01839:Cadps APN 14 12467184 splice site probably benign
IGL01932:Cadps APN 14 12373609 utr 3 prime probably benign
IGL02172:Cadps APN 14 12705681 missense probably damaging 1.00
IGL02175:Cadps APN 14 12467092 missense probably damaging 0.96
IGL02212:Cadps APN 14 12522345 missense possibly damaging 0.94
IGL02351:Cadps APN 14 12597380 missense probably damaging 0.99
IGL02358:Cadps APN 14 12597380 missense probably damaging 0.99
IGL02499:Cadps APN 14 12822725 nonsense probably null
IGL02505:Cadps APN 14 12449759 missense probably damaging 1.00
IGL02591:Cadps APN 14 12473465 missense probably damaging 1.00
IGL02592:Cadps APN 14 12473465 missense probably damaging 1.00
IGL02671:Cadps APN 14 12491824 missense probably damaging 1.00
IGL02956:Cadps APN 14 12418047 splice site probably benign
IGL03029:Cadps APN 14 12376675 missense probably damaging 1.00
IGL03216:Cadps APN 14 12439944 missense probably damaging 1.00
IGL03282:Cadps APN 14 12465856 splice site probably benign
turbo UTSW 14 12491800 missense probably damaging 1.00
R0241:Cadps UTSW 14 12376675 missense probably damaging 1.00
R0241:Cadps UTSW 14 12376675 missense probably damaging 1.00
R0420:Cadps UTSW 14 12491800 missense probably damaging 1.00
R1180:Cadps UTSW 14 12457836 splice site probably benign
R1398:Cadps UTSW 14 12449822 missense probably damaging 1.00
R1678:Cadps UTSW 14 12517802 critical splice donor site probably null
R1792:Cadps UTSW 14 12449802 missense possibly damaging 0.93
R1863:Cadps UTSW 14 12449802 missense possibly damaging 0.93
R1863:Cadps UTSW 14 12505796 missense probably benign 0.09
R1918:Cadps UTSW 14 12546372 missense probably damaging 0.99
R1920:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1921:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1922:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1925:Cadps UTSW 14 12705726 missense probably damaging 1.00
R1966:Cadps UTSW 14 12822450 nonsense probably null
R2013:Cadps UTSW 14 12522337 missense probably damaging 1.00
R2228:Cadps UTSW 14 12465935 missense probably benign 0.05
R2331:Cadps UTSW 14 12603692 missense probably damaging 1.00
R3436:Cadps UTSW 14 12616158 splice site probably null
R3853:Cadps UTSW 14 12509090 splice site probably benign
R3893:Cadps UTSW 14 12488883 utr 3 prime probably benign
R3916:Cadps UTSW 14 12457702 missense probably benign 0.00
R3917:Cadps UTSW 14 12457702 missense probably benign 0.00
R3953:Cadps UTSW 14 12505937 missense probably damaging 1.00
R3966:Cadps UTSW 14 12522161 splice site probably null
R4024:Cadps UTSW 14 12705539 missense probably damaging 1.00
R4079:Cadps UTSW 14 12457702 missense probably benign 0.00
R4230:Cadps UTSW 14 12488987 missense probably damaging 0.98
R4333:Cadps UTSW 14 12467031 missense probably damaging 1.00
R4410:Cadps UTSW 14 12822323 missense probably damaging 0.98
R4586:Cadps UTSW 14 12505808 missense probably damaging 1.00
R4685:Cadps UTSW 14 12467139 missense possibly damaging 0.77
R4698:Cadps UTSW 14 12705654 missense possibly damaging 0.90
R4855:Cadps UTSW 14 12822449 missense unknown
R4898:Cadps UTSW 14 12411588 missense possibly damaging 0.86
R4908:Cadps UTSW 14 12536386 missense probably damaging 1.00
R5208:Cadps UTSW 14 12457711 missense possibly damaging 0.68
R5297:Cadps UTSW 14 12822345 missense probably damaging 1.00
R5328:Cadps UTSW 14 12457790 missense probably benign 0.31
R5408:Cadps UTSW 14 12705759 missense possibly damaging 0.87
R5529:Cadps UTSW 14 12454285 missense probably damaging 1.00
R5567:Cadps UTSW 14 12473497 missense possibly damaging 0.49
R5570:Cadps UTSW 14 12473497 missense possibly damaging 0.49
R5727:Cadps UTSW 14 12486525 nonsense probably null
R5812:Cadps UTSW 14 12376685 missense probably benign
R6361:Cadps UTSW 14 12491778 nonsense probably null
R6767:Cadps UTSW 14 12550888 missense probably damaging 1.00
R6805:Cadps UTSW 14 12467103 missense probably damaging 0.99
R6861:Cadps UTSW 14 12522401 nonsense probably null
R6883:Cadps UTSW 14 12465883 missense probably damaging 0.96
R6887:Cadps UTSW 14 12505811 missense probably damaging 1.00
R6997:Cadps UTSW 14 12505793 missense possibly damaging 0.88
R7102:Cadps UTSW 14 12603738 missense probably damaging 1.00
R7120:Cadps UTSW 14 12439919 missense probably damaging 0.98
R7143:Cadps UTSW 14 12491838 missense probably benign 0.02
R7290:Cadps UTSW 14 12616099 missense probably damaging 1.00
R7614:Cadps UTSW 14 12454260 missense probably damaging 1.00
R7674:Cadps UTSW 14 12411581 missense probably damaging 0.99
R7715:Cadps UTSW 14 12457762 missense probably benign 0.01
R7801:Cadps UTSW 14 12489476 critical splice donor site probably null
R7814:Cadps UTSW 14 12376706 missense probably damaging 0.99
R7915:Cadps UTSW 14 12705544 missense possibly damaging 0.84
R8109:Cadps UTSW 14 12488975 missense probably benign 0.00
R8485:Cadps UTSW 14 12439872 missense probably damaging 1.00
X0018:Cadps UTSW 14 12373690 missense probably damaging 1.00
X0028:Cadps UTSW 14 12467118 missense possibly damaging 0.93
Z1088:Cadps UTSW 14 12467113 missense probably damaging 0.96
Z1177:Cadps UTSW 14 12465880 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGAAAGCAGCATGGAACTC -3'
(R):5'- CATAGGCTGTGTCAATGTGGGAC -3'

Sequencing Primer
(F):5'- ATGGAACTCAATGCTCAGGCTTC -3'
(R):5'- CAATGTGGGACGAGCTGTG -3'
Posted On2020-06-30