Incidental Mutation 'R8087:Ttc3'
ID629744
Institutional Source Beutler Lab
Gene Symbol Ttc3
Ensembl Gene ENSMUSG00000040785
Gene Nametetratricopeptide repeat domain 3
Synonyms2610202A04Rik, D16Ium21, D16Ium21e, TPRD
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.793) question?
Stock #R8087 (G1)
Quality Score165.009
Status Not validated
Chromosome16
Chromosomal Location94370618-94469343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94442953 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 1272 (P1272L)
Ref Sequence ENSEMBL: ENSMUSP00000112801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117648] [ENSMUST00000122895] [ENSMUST00000143145] [ENSMUST00000147352] [ENSMUST00000151770] [ENSMUST00000152117] [ENSMUST00000155692] [ENSMUST00000231569] [ENSMUST00000231915] [ENSMUST00000232395] [ENSMUST00000232660]
Predicted Effect probably benign
Transcript: ENSMUST00000117648
AA Change: P1272L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112801
Gene: ENSMUSG00000040785
AA Change: P1272L

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 2e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1170 1190 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
low complexity region 1278 1291 N/A INTRINSIC
coiled coil region 1472 1570 N/A INTRINSIC
low complexity region 1876 1887 N/A INTRINSIC
RING 1931 1970 7e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122895
SMART Domains Protein: ENSMUSP00000123037
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143145
Predicted Effect probably benign
Transcript: ENSMUST00000147352
SMART Domains Protein: ENSMUSP00000116097
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151770
SMART Domains Protein: ENSMUSP00000121349
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 3e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152117
SMART Domains Protein: ENSMUSP00000116896
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
SCOP:d1ihga1 69 201 6e-8 SMART
Blast:TPR 175 208 1e-14 BLAST
low complexity region 319 331 N/A INTRINSIC
coiled coil region 364 395 N/A INTRINSIC
low complexity region 617 631 N/A INTRINSIC
low complexity region 635 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155692
SMART Domains Protein: ENSMUSP00000122724
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 250 283 3.61e-2 SMART
TPR 284 317 3.32e-1 SMART
Blast:TPR 319 351 3e-12 BLAST
low complexity region 463 478 N/A INTRINSIC
TPR 595 628 2.55e-2 SMART
low complexity region 739 751 N/A INTRINSIC
coiled coil region 784 815 N/A INTRINSIC
low complexity region 1037 1051 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231569
AA Change: P917L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000231915
Predicted Effect probably benign
Transcript: ENSMUST00000232368
Predicted Effect probably benign
Transcript: ENSMUST00000232395
AA Change: P1272L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000232660
AA Change: P1272L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.7%
  • 20x: 83.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik G T 14: 32,785,969 probably benign Het
4930451I11Rik A G 7: 126,830,880 V73A possibly damaging Het
A830010M20Rik T A 5: 107,485,087 Y264N probably damaging Het
Abcg1 T C 17: 31,064,485 L48P probably benign Het
Ablim1 A G 19: 57,182,256 W18R Het
Acss1 A G 2: 150,642,748 F192L probably damaging Het
Arhgap32 A G 9: 32,257,028 N769S probably benign Het
BC004004 T A 17: 29,294,090 L163I probably damaging Het
Bco1 A T 8: 117,108,762 T151S possibly damaging Het
C1ra G A 6: 124,513,872 V75I probably damaging Het
Cadps A C 14: 12,536,380 W527G probably damaging Het
Calca T C 7: 114,632,574 N85D probably benign Het
Capn13 A G 17: 73,316,284 L644P probably damaging Het
Ccdc57 T C 11: 120,897,879 I381V probably benign Het
Ccr1 A G 9: 123,964,334 V53A probably benign Het
Cd27 G T 6: 125,233,362 A234D possibly damaging Het
Cnpy4 T A 5: 138,190,270 V46E probably damaging Het
Cspp1 T G 1: 10,104,264 D647E possibly damaging Het
Ctnnd1 A T 2: 84,610,876 F660I possibly damaging Het
Dchs1 A T 7: 105,753,499 S3279T probably benign Het
Ddx11 T A 17: 66,149,993 Y772N probably damaging Het
Dgkd T A 1: 87,916,847 V245E probably damaging Het
Dmgdh C T 13: 93,703,871 T270I possibly damaging Het
E330009J07Rik T A 6: 40,418,592 D194V possibly damaging Het
Elac2 A G 11: 64,979,208 H33R probably benign Het
Emilin1 T A 5: 30,917,100 D228E probably damaging Het
F2rl1 A G 13: 95,513,999 L125P probably damaging Het
Fam186a A G 15: 99,941,844 V2173A possibly damaging Het
Foxp4 C A 17: 47,904,430 G30C probably damaging Het
Fyn T A 10: 39,529,557 L273* probably null Het
Garnl3 G T 2: 33,045,536 D196E probably benign Het
Glb1 A T 9: 114,430,415 T220S probably damaging Het
Gm9268 A T 7: 43,047,670 Y717F probably benign Het
Hsdl2 G T 4: 59,592,228 A31S unknown Het
Irak3 T A 10: 120,182,535 I103F probably benign Het
Khdrbs2 A T 1: 32,414,976 M148L probably benign Het
Kif2c A T 4: 117,165,418 S500R possibly damaging Het
Kmt2c T C 5: 25,329,252 Y1500C probably damaging Het
Lrp2 T C 2: 69,448,129 D3960G probably damaging Het
Map2k6 A T 11: 110,490,176 I39L probably benign Het
Muc13 G T 16: 33,799,027 Q48H unknown Het
Nlrp1b A T 11: 71,172,071 I721N probably benign Het
Ntsr1 A T 2: 180,500,172 probably benign Het
Nubp1 T C 16: 10,420,348 probably null Het
Olfr92 T C 17: 37,111,548 I145V probably benign Het
Ovol3 A C 7: 30,234,372 D108E probably damaging Het
Pcdhb4 C A 18: 37,308,664 N342K probably damaging Het
Pcgf3 A G 5: 108,486,236 D120G probably benign Het
Pde6b T C 5: 108,388,462 V8A probably benign Het
Pkhd1 G T 1: 20,523,089 T1600K probably damaging Het
Pkp3 A G 7: 141,087,638 I451V possibly damaging Het
Plce1 A G 19: 38,736,521 T1439A probably damaging Het
Prr27 C A 5: 87,846,309 N347K probably benign Het
Prss41 T C 17: 23,837,102 Y259C probably damaging Het
Rasgef1b T C 5: 99,221,389 I457V probably benign Het
Rspry1 G A 8: 94,654,297 V534M probably benign Het
Rxrb T C 17: 34,035,789 V306A probably benign Het
Sim1 T C 10: 50,909,555 M240T possibly damaging Het
Slc22a4 A T 11: 53,996,061 I285K possibly damaging Het
Slc4a2 GGCAGCAGCAGCAGCAGCA GGCAGCAGCAGCAGCA 5: 24,438,749 probably benign Het
Snx19 T C 9: 30,464,402 M993T probably benign Het
Sstr2 G A 11: 113,624,675 R140H probably damaging Het
Syne1 C T 10: 5,333,034 R1553Q probably benign Het
Tchp T C 5: 114,719,604 I386T probably damaging Het
Traf7 G T 17: 24,512,064 S304R possibly damaging Het
Trcg1 C T 9: 57,248,674 L798F probably damaging Het
Ttf2 G T 3: 100,964,096 A83E probably damaging Het
Uba3 T A 6: 97,185,383 I421F possibly damaging Het
Ube3b T C 5: 114,412,489 probably null Het
Ulk4 A G 9: 121,266,251 L112P probably damaging Het
Unc5a A G 13: 54,996,172 N150S probably damaging Het
Vac14 A T 8: 110,719,900 K760N probably benign Het
Vmn2r113 A T 17: 22,958,737 I832L possibly damaging Het
Xpot T C 10: 121,601,327 I830V probably benign Het
Zfp101 G A 17: 33,381,003 T593I probably benign Het
Zfp54 A C 17: 21,434,998 T585P probably damaging Het
Zfp663 T C 2: 165,353,759 D180G probably benign Het
Other mutations in Ttc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Ttc3 APN 16 94426761 splice site probably null
IGL00979:Ttc3 APN 16 94456718 missense probably damaging 1.00
IGL01520:Ttc3 APN 16 94390207 missense probably benign 0.04
IGL01663:Ttc3 APN 16 94409731 critical splice donor site probably null
IGL01720:Ttc3 APN 16 94385369 missense probably damaging 0.99
IGL01736:Ttc3 APN 16 94442527 missense probably damaging 0.99
IGL02045:Ttc3 APN 16 94409681 splice site probably benign
IGL02203:Ttc3 APN 16 94418598 splice site probably benign
IGL02327:Ttc3 APN 16 94448108 missense probably damaging 1.00
IGL02794:Ttc3 APN 16 94467926 missense probably damaging 1.00
IGL02898:Ttc3 APN 16 94419426 missense probably damaging 1.00
PIT4378001:Ttc3 UTSW 16 94410906 missense probably benign 0.01
R0064:Ttc3 UTSW 16 94422247 missense possibly damaging 0.79
R0098:Ttc3 UTSW 16 94390265 missense probably benign 0.02
R0112:Ttc3 UTSW 16 94385322 splice site probably benign
R0135:Ttc3 UTSW 16 94462268 missense possibly damaging 0.92
R0480:Ttc3 UTSW 16 94432004 nonsense probably null
R0513:Ttc3 UTSW 16 94426212 missense probably damaging 1.00
R0532:Ttc3 UTSW 16 94387330 splice site probably benign
R0607:Ttc3 UTSW 16 94456785 nonsense probably null
R0742:Ttc3 UTSW 16 94459880 missense probably benign 0.23
R0905:Ttc3 UTSW 16 94456789 nonsense probably null
R1118:Ttc3 UTSW 16 94416268 splice site probably benign
R1355:Ttc3 UTSW 16 94418637 missense possibly damaging 0.46
R1370:Ttc3 UTSW 16 94418637 missense possibly damaging 0.46
R1486:Ttc3 UTSW 16 94448129 missense probably damaging 1.00
R1598:Ttc3 UTSW 16 94422297 missense probably damaging 1.00
R1641:Ttc3 UTSW 16 94443317 missense probably benign 0.19
R2092:Ttc3 UTSW 16 94442832 missense probably benign 0.02
R2232:Ttc3 UTSW 16 94459972 missense probably benign 0.00
R2339:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R2342:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R2842:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R3117:Ttc3 UTSW 16 94442563 missense possibly damaging 0.51
R4194:Ttc3 UTSW 16 94422277 missense probably damaging 0.99
R4329:Ttc3 UTSW 16 94466961 missense probably damaging 1.00
R4431:Ttc3 UTSW 16 94410958 critical splice donor site probably null
R4530:Ttc3 UTSW 16 94466877 intron probably benign
R4531:Ttc3 UTSW 16 94466877 intron probably benign
R4532:Ttc3 UTSW 16 94466877 intron probably benign
R4533:Ttc3 UTSW 16 94466877 intron probably benign
R4588:Ttc3 UTSW 16 94442901 missense probably benign 0.01
R4625:Ttc3 UTSW 16 94388272 nonsense probably null
R4676:Ttc3 UTSW 16 94442761 missense probably damaging 1.00
R4700:Ttc3 UTSW 16 94439241 splice site probably null
R4856:Ttc3 UTSW 16 94390283 missense probably benign 0.32
R4867:Ttc3 UTSW 16 94454515 missense probably damaging 0.96
R4885:Ttc3 UTSW 16 94419465 missense probably damaging 1.00
R4885:Ttc3 UTSW 16 94426831 critical splice donor site probably null
R4899:Ttc3 UTSW 16 94429455 missense probably damaging 1.00
R4997:Ttc3 UTSW 16 94452982 missense probably damaging 1.00
R5023:Ttc3 UTSW 16 94429359 missense probably benign 0.01
R5105:Ttc3 UTSW 16 94466934 missense possibly damaging 0.94
R5205:Ttc3 UTSW 16 94448059 missense probably benign 0.07
R5287:Ttc3 UTSW 16 94459844 missense probably benign 0.00
R5338:Ttc3 UTSW 16 94384041 missense probably damaging 0.99
R5347:Ttc3 UTSW 16 94429620 missense probably damaging 1.00
R5403:Ttc3 UTSW 16 94459844 missense probably benign 0.00
R5460:Ttc3 UTSW 16 94457382 missense probably benign 0.32
R5739:Ttc3 UTSW 16 94439324 nonsense probably null
R6242:Ttc3 UTSW 16 94442695 missense probably benign 0.04
R6253:Ttc3 UTSW 16 94457413 critical splice donor site probably null
R6455:Ttc3 UTSW 16 94418623 start codon destroyed probably null 0.83
R6559:Ttc3 UTSW 16 94422349 critical splice donor site probably null
R6564:Ttc3 UTSW 16 94442611 missense probably damaging 1.00
R6932:Ttc3 UTSW 16 94443453 missense probably benign
R7331:Ttc3 UTSW 16 94394359 missense probably benign 0.27
R7497:Ttc3 UTSW 16 94418682 missense possibly damaging 0.93
R7610:Ttc3 UTSW 16 94427838 missense probably benign 0.11
R7738:Ttc3 UTSW 16 94387382 missense probably benign 0.00
R7970:Ttc3 UTSW 16 94457364 missense probably damaging 1.00
R8052:Ttc3 UTSW 16 94467989 missense probably benign 0.09
R8309:Ttc3 UTSW 16 94466979 missense probably damaging 1.00
R8320:Ttc3 UTSW 16 94418676 missense probably damaging 1.00
R8322:Ttc3 UTSW 16 94454492 missense probably damaging 1.00
R8518:Ttc3 UTSW 16 94457379 missense probably benign 0.21
X0022:Ttc3 UTSW 16 94442525 missense probably benign 0.00
Y5378:Ttc3 UTSW 16 94412129 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCACTAAATCCAACTGCTAGGG -3'
(R):5'- AAATGTTGGCCAAAGGTGTG -3'

Sequencing Primer
(F):5'- CTGCTAGGGAATTTCAACCAGATG -3'
(R):5'- TGTGTAAATGCTAGTGAACTGCGAC -3'
Posted On2020-06-30