Incidental Mutation 'R8087:Or2h2c'
ID 629753
Institutional Source Beutler Lab
Gene Symbol Or2h2c
Ensembl Gene ENSMUSG00000096477
Gene Name olfactory receptor family 2 subfamily H member 2C
Synonyms MOR256-29, Olfr92, GA_x6K02T2PSCP-1552066-1551128
MMRRC Submission 067520-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R8087 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 37421934-37422872 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37422440 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 145 (I145V)
Ref Sequence ENSEMBL: ENSMUSP00000150998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168659] [ENSMUST00000214994] [ENSMUST00000216341]
AlphaFold L7N475
Predicted Effect probably benign
Transcript: ENSMUST00000168659
AA Change: I145V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128393
Gene: ENSMUSG00000096477
AA Change: I145V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 23 304 5.1e-7 PFAM
Pfam:7tm_4 29 306 3.4e-50 PFAM
Pfam:7tm_1 39 288 1.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214994
AA Change: I145V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216341
AA Change: I145V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.7%
  • 20x: 83.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik A G 7: 126,430,052 (GRCm39) V73A possibly damaging Het
Abcg1 T C 17: 31,283,459 (GRCm39) L48P probably benign Het
Ablim1 A G 19: 57,170,688 (GRCm39) W18R Het
Acss1 A G 2: 150,484,668 (GRCm39) F192L probably damaging Het
Arhgap32 A G 9: 32,168,324 (GRCm39) N769S probably benign Het
BC004004 T A 17: 29,513,064 (GRCm39) L163I probably damaging Het
Bco1 A T 8: 117,835,501 (GRCm39) T151S possibly damaging Het
Btbd8 T A 5: 107,632,953 (GRCm39) Y264N probably damaging Het
C1ra G A 6: 124,490,831 (GRCm39) V75I probably damaging Het
Cadps A C 14: 12,536,380 (GRCm38) W527G probably damaging Het
Calca T C 7: 114,231,809 (GRCm39) N85D probably benign Het
Capn13 A G 17: 73,623,279 (GRCm39) L644P probably damaging Het
Ccdc57 T C 11: 120,788,705 (GRCm39) I381V probably benign Het
Ccr1 A G 9: 123,764,371 (GRCm39) V53A probably benign Het
Cd27 G T 6: 125,210,325 (GRCm39) A234D possibly damaging Het
Cnpy4 T A 5: 138,188,532 (GRCm39) V46E probably damaging Het
Cspp1 T G 1: 10,174,489 (GRCm39) D647E possibly damaging Het
Ctnnd1 A T 2: 84,441,220 (GRCm39) F660I possibly damaging Het
Dchs1 A T 7: 105,402,706 (GRCm39) S3279T probably benign Het
Ddx11 T A 17: 66,456,988 (GRCm39) Y772N probably damaging Het
Dennd11 T A 6: 40,395,526 (GRCm39) D194V possibly damaging Het
Dgkd T A 1: 87,844,569 (GRCm39) V245E probably damaging Het
Dmgdh C T 13: 93,840,379 (GRCm39) T270I possibly damaging Het
Elac2 A G 11: 64,870,034 (GRCm39) H33R probably benign Het
Emilin1 T A 5: 31,074,444 (GRCm39) D228E probably damaging Het
F2rl1 A G 13: 95,650,507 (GRCm39) L125P probably damaging Het
Fam186a A G 15: 99,839,725 (GRCm39) V2173A possibly damaging Het
Foxp4 C A 17: 48,215,355 (GRCm39) G30C probably damaging Het
Fyn T A 10: 39,405,553 (GRCm39) L273* probably null Het
Garnl3 G T 2: 32,935,548 (GRCm39) D196E probably benign Het
Glb1 A T 9: 114,259,483 (GRCm39) T220S probably damaging Het
Hsdl2 G T 4: 59,592,228 (GRCm39) A31S unknown Het
Irak3 T A 10: 120,018,440 (GRCm39) I103F probably benign Het
Khdrbs2 A T 1: 32,454,057 (GRCm39) M148L probably benign Het
Kif2c A T 4: 117,022,615 (GRCm39) S500R possibly damaging Het
Kmt2c T C 5: 25,534,250 (GRCm39) Y1500C probably damaging Het
Lrp2 T C 2: 69,278,473 (GRCm39) D3960G probably damaging Het
Map2k6 A T 11: 110,381,002 (GRCm39) I39L probably benign Het
Muc13 G T 16: 33,619,397 (GRCm39) Q48H unknown Het
Nlrp1b A T 11: 71,062,897 (GRCm39) I721N probably benign Het
Ntsr1 A T 2: 180,141,965 (GRCm39) probably benign Het
Nubp1 T C 16: 10,238,212 (GRCm39) probably null Het
Ovol3 A C 7: 29,933,797 (GRCm39) D108E probably damaging Het
Pcdhb4 C A 18: 37,441,717 (GRCm39) N342K probably damaging Het
Pcgf3 A G 5: 108,634,102 (GRCm39) D120G probably benign Het
Pde6b T C 5: 108,536,328 (GRCm39) V8A probably benign Het
Pkhd1 G T 1: 20,593,313 (GRCm39) T1600K probably damaging Het
Pkp3 A G 7: 140,667,551 (GRCm39) I451V possibly damaging Het
Plce1 A G 19: 38,724,965 (GRCm39) T1439A probably damaging Het
Prr27 C A 5: 87,994,168 (GRCm39) N347K probably benign Het
Prss41 T C 17: 24,056,076 (GRCm39) Y259C probably damaging Het
Rasgef1b T C 5: 99,369,248 (GRCm39) I457V probably benign Het
Rspry1 G A 8: 95,380,925 (GRCm39) V534M probably benign Het
Rxrb T C 17: 34,254,763 (GRCm39) V306A probably benign Het
Sim1 T C 10: 50,785,651 (GRCm39) M240T possibly damaging Het
Slc22a4 A T 11: 53,886,887 (GRCm39) I285K possibly damaging Het
Slc4a2 GGCAGCAGCAGCAGCAGCA GGCAGCAGCAGCAGCA 5: 24,643,747 (GRCm39) probably benign Het
Snx19 T C 9: 30,375,698 (GRCm39) M993T probably benign Het
Sstr2 G A 11: 113,515,501 (GRCm39) R140H probably damaging Het
Syne1 C T 10: 5,283,034 (GRCm39) R1553Q probably benign Het
Tchp T C 5: 114,857,665 (GRCm39) I386T probably damaging Het
Tmem273 G T 14: 32,507,926 (GRCm39) probably benign Het
Traf7 G T 17: 24,731,038 (GRCm39) S304R possibly damaging Het
Trcg1 C T 9: 57,155,957 (GRCm39) L798F probably damaging Het
Ttc3 C T 16: 94,243,812 (GRCm39) P1272L probably benign Het
Ttf2 G T 3: 100,871,412 (GRCm39) A83E probably damaging Het
Uba3 T A 6: 97,162,344 (GRCm39) I421F possibly damaging Het
Ube3b T C 5: 114,550,550 (GRCm39) probably null Het
Ulk4 A G 9: 121,095,317 (GRCm39) L112P probably damaging Het
Unc5a A G 13: 55,143,985 (GRCm39) N150S probably damaging Het
Vac14 A T 8: 111,446,532 (GRCm39) K760N probably benign Het
Vmn2r113 A T 17: 23,177,711 (GRCm39) I832L possibly damaging Het
Vmn2r-ps158 A T 7: 42,697,094 (GRCm39) Y717F probably benign Het
Xpot T C 10: 121,437,232 (GRCm39) I830V probably benign Het
Zfp101 G A 17: 33,599,977 (GRCm39) T593I probably benign Het
Zfp54 A C 17: 21,655,260 (GRCm39) T585P probably damaging Het
Zfp663 T C 2: 165,195,679 (GRCm39) D180G probably benign Het
Other mutations in Or2h2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Or2h2c APN 17 37,422,701 (GRCm39) missense probably damaging 1.00
IGL02850:Or2h2c APN 17 37,422,865 (GRCm39) missense probably benign 0.35
IGL03209:Or2h2c APN 17 37,422,413 (GRCm39) missense probably benign 0.04
R0579:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R0580:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R0582:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R0615:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R0669:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R0674:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R0675:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R2424:Or2h2c UTSW 17 37,422,408 (GRCm39) missense probably benign 0.02
R3714:Or2h2c UTSW 17 37,422,227 (GRCm39) missense probably damaging 1.00
R4393:Or2h2c UTSW 17 37,424,971 (GRCm39) intron probably benign
R5811:Or2h2c UTSW 17 37,422,649 (GRCm39) missense probably benign 0.00
R6615:Or2h2c UTSW 17 37,422,494 (GRCm39) missense probably damaging 1.00
R6853:Or2h2c UTSW 17 37,422,400 (GRCm39) missense probably benign 0.02
R6876:Or2h2c UTSW 17 37,422,098 (GRCm39) missense probably damaging 1.00
R7665:Or2h2c UTSW 17 37,422,283 (GRCm39) missense probably benign 0.20
R9224:Or2h2c UTSW 17 37,422,767 (GRCm39) missense possibly damaging 0.53
R9439:Or2h2c UTSW 17 37,422,205 (GRCm39) missense probably damaging 1.00
R9541:Or2h2c UTSW 17 37,422,824 (GRCm39) missense probably benign 0.00
R9559:Or2h2c UTSW 17 37,422,509 (GRCm39) missense possibly damaging 0.84
Z1177:Or2h2c UTSW 17 37,422,322 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGGCAATGGCACCATAAGAGAC -3'
(R):5'- AAGACCATCAGCTTCCTGGG -3'

Sequencing Primer
(F):5'- TGAGGCTCAGAGGAACAACCAC -3'
(R):5'- CCTGGGATGCTTTGTCCAGC -3'
Posted On 2020-06-30