Incidental Mutation 'R8088:Rtel1'
ID629773
Institutional Source Beutler Lab
Gene Symbol Rtel1
Ensembl Gene ENSMUSG00000038685
Gene Nameregulator of telomere elongation helicase 1
SynonymsNhl, Rtel, KIAA1088, C20ORF41
Accession Numbers

Ncbi RefSeq: NM_001001882.3, NM_001166665.1, NM_001166666.1, NM_001166667.1, NM_001166668.1; MGI: 2139369

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8088 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location181319739-181356616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181322345 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 46 (T46A)
Ref Sequence ENSEMBL: ENSMUSP00000053120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048608] [ENSMUST00000054622] [ENSMUST00000098971] [ENSMUST00000108814] [ENSMUST00000108815] [ENSMUST00000153112]
Predicted Effect probably damaging
Transcript: ENSMUST00000048608
AA Change: T46A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043563
Gene: ENSMUSG00000038685
AA Change: T46A

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000054622
AA Change: T46A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053120
Gene: ENSMUSG00000038685
AA Change: T46A

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1075 1092 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098971
AA Change: T46A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096571
Gene: ENSMUSG00000038685
AA Change: T46A

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1036 1053 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108814
AA Change: T46A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104442
Gene: ENSMUSG00000038685
AA Change: T46A

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1069 1086 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108815
AA Change: T46A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104443
Gene: ENSMUSG00000038685
AA Change: T46A

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153112
AA Change: T46A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118810
Gene: ENSMUSG00000038685
AA Change: T46A

DomainStartEndE-ValueType
Pfam:ResIII 14 101 1.8e-7 PFAM
Pfam:DEAD_2 111 161 3.3e-16 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 100% (69/69)
MGI Phenotype Strain: 3772371; 3052235
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase which functions in the stability, protection and elongation of telomeres and interacts with proteins in the shelterin complex known to protect telomeres during DNA replication. Mutations in this gene have been associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome. Read-through transcription of this gene into the neighboring downstream gene, which encodes tumor necrosis factor receptor superfamily, member 6b, generates a non-coding transcript. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal development of the neural tube, brain, heart, vasculature, placenta, and allantois and chromosomal abnormalities in differentiating cells. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted(5) Gene trapped(28)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,318 M453V probably benign Het
Atp2c1 A T 9: 105,452,569 probably null Het
Ccdc134 T A 15: 82,131,789 probably benign Het
Ccdc162 G T 10: 41,623,414 H1066Q possibly damaging Het
Ccna1 A G 3: 55,051,071 S64P probably benign Het
Defb12 T C 8: 19,112,821 probably null Het
Dhx9 C A 1: 153,462,697 V738L probably benign Het
Dnah10 A G 5: 124,754,266 N843S probably benign Het
Dspp A G 5: 104,177,256 D495G unknown Het
Dus2 A G 8: 106,030,441 M88V probably benign Het
Dusp13 A G 14: 21,741,237 V49A probably benign Het
Ehbp1 G A 11: 22,089,572 H843Y probably null Het
Entpd3 A C 9: 120,554,173 R91S probably benign Het
Fam207a T C 10: 77,514,395 N53S probably benign Het
Fam83c C A 2: 155,831,639 V210F probably damaging Het
Flot1 G A 17: 35,829,978 A287T probably damaging Het
Gm11639 A T 11: 104,998,246 I4163L probably benign Het
Gm19410 A G 8: 35,806,841 K1412E probably benign Het
Gsn G A 2: 35,292,647 V241M possibly damaging Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Heatr5a T C 12: 51,947,996 D451G possibly damaging Het
Hmcn2 G A 2: 31,426,903 W3831* probably null Het
Il3 A G 11: 54,265,549 V119A probably benign Het
Jam3 T C 9: 27,098,860 K276R probably benign Het
Kcnt1 G A 2: 25,894,314 G277D possibly damaging Het
Kif28 T A 1: 179,700,354 D744V probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Loxhd1 T C 18: 77,342,013 I535T possibly damaging Het
Lzts1 A C 8: 69,135,822 L494R probably benign Het
Mettl4 A G 17: 94,735,367 V347A probably damaging Het
Mff A G 1: 82,751,649 E270G probably damaging Het
Mroh2b A T 15: 4,900,503 I24F possibly damaging Het
Muc16 A T 9: 18,519,300 Y8102* probably null Het
Myh14 A T 7: 44,665,496 M1K probably null Het
Myo18b T A 5: 112,879,510 probably benign Het
Neurl1a C A 19: 47,257,434 P502T probably damaging Het
Nrp1 G A 8: 128,468,516 W484* probably null Het
Olfr131 T A 17: 38,082,561 H139L possibly damaging Het
Olfr1317 T A 2: 112,142,257 I104N probably benign Het
Pcdhac1 T C 18: 37,091,754 V540A possibly damaging Het
Pcdhga9 A G 18: 37,736,954 probably benign Het
Pm20d1 A C 1: 131,801,763 N176T probably benign Het
Pnldc1 T C 17: 12,897,302 D271G probably damaging Het
Pold3 A G 7: 100,112,301 V63A probably damaging Het
Rbm18 A C 2: 36,127,184 S61A probably benign Het
Rdh14 T C 12: 10,394,551 L134P probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rtn3 T C 19: 7,434,998 I823V probably damaging Het
S1pr1 A G 3: 115,712,034 S304P probably damaging Het
Scfd2 A G 5: 74,531,363 V86A probably benign Het
Scgb1a1 C T 19: 9,085,235 V66M probably damaging Het
Sec31a A T 5: 100,378,862 M46K Het
Sgsm1 A G 5: 113,255,268 M971T probably damaging Het
Slc5a11 T C 7: 123,265,728 I419T probably benign Het
Slco6d1 A T 1: 98,466,706 T372S possibly damaging Het
Spata31 T A 13: 64,920,865 Y276N probably benign Het
Sprr2k C T 3: 92,433,489 R49W unknown Het
Sspo G A 6: 48,457,613 C1013Y probably damaging Het
Ssr2 A G 3: 88,579,883 R2G possibly damaging Het
St18 C A 1: 6,828,005 T677K probably benign Het
Thap11 A T 8: 105,855,895 I179F probably damaging Het
Trf C A 9: 103,211,931 G586C probably damaging Het
Umodl1 A G 17: 30,973,796 N299S probably benign Het
Xrcc5 C A 1: 72,312,436 A55E probably damaging Het
Other mutations in Rtel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Rtel1 APN 2 181354401 missense probably benign 0.16
IGL01957:Rtel1 APN 2 181349313 unclassified probably benign
IGL02247:Rtel1 APN 2 181351341 nonsense probably null
IGL02414:Rtel1 APN 2 181335972 missense probably benign 0.01
IGL02448:Rtel1 APN 2 181336037 missense probably benign 0.00
IGL03053:Rtel1 APN 2 181351944 missense probably benign 0.02
IGL03059:Rtel1 APN 2 181350183 missense probably benign 0.01
IGL03326:Rtel1 APN 2 181355561 unclassified probably benign
PIT4283001:Rtel1 UTSW 2 181346890 missense probably benign 0.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0051:Rtel1 UTSW 2 181350656 nonsense probably null
R0051:Rtel1 UTSW 2 181350656 nonsense probably null
R0147:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0148:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0316:Rtel1 UTSW 2 181356002 missense possibly damaging 0.87
R0628:Rtel1 UTSW 2 181351881 missense probably benign 0.03
R0940:Rtel1 UTSW 2 181322803 missense probably benign 0.36
R1165:Rtel1 UTSW 2 181334939 missense probably benign 0.26
R1213:Rtel1 UTSW 2 181351335 missense probably benign 0.01
R1291:Rtel1 UTSW 2 181351043 missense probably damaging 1.00
R1353:Rtel1 UTSW 2 181349231 missense probably benign
R1398:Rtel1 UTSW 2 181335865 intron probably null
R1796:Rtel1 UTSW 2 181352103 missense probably benign 0.01
R1973:Rtel1 UTSW 2 181351626 missense probably benign 0.04
R2033:Rtel1 UTSW 2 181351863 nonsense probably null
R2144:Rtel1 UTSW 2 181323706 missense probably damaging 0.97
R2265:Rtel1 UTSW 2 181354368 missense probably damaging 1.00
R2269:Rtel1 UTSW 2 181336003 missense probably benign 0.00
R2416:Rtel1 UTSW 2 181340531 missense possibly damaging 0.66
R2865:Rtel1 UTSW 2 181349972 missense probably benign 0.36
R3508:Rtel1 UTSW 2 181322409 missense probably benign 0.32
R4242:Rtel1 UTSW 2 181349934 missense probably damaging 1.00
R4377:Rtel1 UTSW 2 181355796 missense probably damaging 1.00
R4702:Rtel1 UTSW 2 181352169 missense probably benign 0.30
R4706:Rtel1 UTSW 2 181323746 critical splice donor site probably null
R4817:Rtel1 UTSW 2 181355935 missense possibly damaging 0.82
R5020:Rtel1 UTSW 2 181322514 splice site probably null
R5069:Rtel1 UTSW 2 181355492 missense probably benign 0.03
R5222:Rtel1 UTSW 2 181346983 intron probably benign
R5268:Rtel1 UTSW 2 181340561 missense probably benign 0.03
R5291:Rtel1 UTSW 2 181352095 missense possibly damaging 0.47
R5588:Rtel1 UTSW 2 181352100 missense probably benign
R5682:Rtel1 UTSW 2 181349972 missense probably benign 0.19
R5796:Rtel1 UTSW 2 181340506 missense probably benign 0.26
R5931:Rtel1 UTSW 2 181330815 nonsense probably null
R6249:Rtel1 UTSW 2 181351682 missense probably damaging 1.00
R6465:Rtel1 UTSW 2 181335940 missense possibly damaging 0.68
R6616:Rtel1 UTSW 2 181352786 missense possibly damaging 0.68
R6800:Rtel1 UTSW 2 181322463 missense probably benign 0.31
R6835:Rtel1 UTSW 2 181355953 missense probably benign 0.04
R6917:Rtel1 UTSW 2 181338277 makesense probably null
R7264:Rtel1 UTSW 2 181351861 missense not run
R7381:Rtel1 UTSW 2 181330815 nonsense probably null
R7523:Rtel1 UTSW 2 181322315 missense probably damaging 1.00
R7587:Rtel1 UTSW 2 181322315 missense probably damaging 1.00
R7681:Rtel1 UTSW 2 181322394 missense probably damaging 0.99
R7871:Rtel1 UTSW 2 181321029 missense probably damaging 1.00
R7912:Rtel1 UTSW 2 181356076 missense possibly damaging 0.56
R8007:Rtel1 UTSW 2 181334974 missense probably damaging 1.00
R8062:Rtel1 UTSW 2 181340567 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GCTAATGAGGACATCTTAACTTACAGC -3'
(R):5'- CTCCAAGAACAGAGGAAGCCTG -3'

Sequencing Primer
(F):5'- CAGCTTTTAGTGGAAAATGTCATG -3'
(R):5'- ATGAACTGGCCCTGTCACAG -3'
Posted On2020-06-30