Incidental Mutation 'R8088:Mroh2b'
ID629809
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Namemaestro heat-like repeat family member 2B
Synonyms4930455B06Rik, Heatr7b2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R8088 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location4898737-4962205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4900503 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 24 (I24F)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045736
AA Change: I24F

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: I24F

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,318 M453V probably benign Het
Atp2c1 A T 9: 105,452,569 probably null Het
Ccdc134 T A 15: 82,131,789 probably benign Het
Ccdc162 G T 10: 41,623,414 H1066Q possibly damaging Het
Ccna1 A G 3: 55,051,071 S64P probably benign Het
Defb12 T C 8: 19,112,821 probably null Het
Dhx9 C A 1: 153,462,697 V738L probably benign Het
Dnah10 A G 5: 124,754,266 N843S probably benign Het
Dspp A G 5: 104,177,256 D495G unknown Het
Dus2 A G 8: 106,030,441 M88V probably benign Het
Dusp13 A G 14: 21,741,237 V49A probably benign Het
Ehbp1 G A 11: 22,089,572 H843Y probably null Het
Entpd3 A C 9: 120,554,173 R91S probably benign Het
Fam207a T C 10: 77,514,395 N53S probably benign Het
Fam83c C A 2: 155,831,639 V210F probably damaging Het
Flot1 G A 17: 35,829,978 A287T probably damaging Het
Gm11639 A T 11: 104,998,246 I4163L probably benign Het
Gm19410 A G 8: 35,806,841 K1412E probably benign Het
Gsn G A 2: 35,292,647 V241M possibly damaging Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Heatr5a T C 12: 51,947,996 D451G possibly damaging Het
Hmcn2 G A 2: 31,426,903 W3831* probably null Het
Il3 A G 11: 54,265,549 V119A probably benign Het
Jam3 T C 9: 27,098,860 K276R probably benign Het
Kcnt1 G A 2: 25,894,314 G277D possibly damaging Het
Kif28 T A 1: 179,700,354 D744V probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Loxhd1 T C 18: 77,342,013 I535T possibly damaging Het
Lzts1 A C 8: 69,135,822 L494R probably benign Het
Mettl4 A G 17: 94,735,367 V347A probably damaging Het
Mff A G 1: 82,751,649 E270G probably damaging Het
Muc16 A T 9: 18,519,300 Y8102* probably null Het
Myh14 A T 7: 44,665,496 M1K probably null Het
Myo18b T A 5: 112,879,510 probably benign Het
Neurl1a C A 19: 47,257,434 P502T probably damaging Het
Nrp1 G A 8: 128,468,516 W484* probably null Het
Olfr131 T A 17: 38,082,561 H139L possibly damaging Het
Olfr1317 T A 2: 112,142,257 I104N probably benign Het
Pcdhac1 T C 18: 37,091,754 V540A possibly damaging Het
Pcdhga9 A G 18: 37,736,954 probably benign Het
Pm20d1 A C 1: 131,801,763 N176T probably benign Het
Pnldc1 T C 17: 12,897,302 D271G probably damaging Het
Pold3 A G 7: 100,112,301 V63A probably damaging Het
Rbm18 A C 2: 36,127,184 S61A probably benign Het
Rdh14 T C 12: 10,394,551 L134P probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rtel1 A G 2: 181,322,345 T46A probably damaging Het
Rtn3 T C 19: 7,434,998 I823V probably damaging Het
S1pr1 A G 3: 115,712,034 S304P probably damaging Het
Scfd2 A G 5: 74,531,363 V86A probably benign Het
Scgb1a1 C T 19: 9,085,235 V66M probably damaging Het
Sec31a A T 5: 100,378,862 M46K Het
Sgsm1 A G 5: 113,255,268 M971T probably damaging Het
Slc5a11 T C 7: 123,265,728 I419T probably benign Het
Slco6d1 A T 1: 98,466,706 T372S possibly damaging Het
Spata31 T A 13: 64,920,865 Y276N probably benign Het
Sprr2k C T 3: 92,433,489 R49W unknown Het
Sspo G A 6: 48,457,613 C1013Y probably damaging Het
Ssr2 A G 3: 88,579,883 R2G possibly damaging Het
St18 C A 1: 6,828,005 T677K probably benign Het
Thap11 A T 8: 105,855,895 I179F probably damaging Het
Trf C A 9: 103,211,931 G586C probably damaging Het
Umodl1 A G 17: 30,973,796 N299S probably benign Het
Xrcc5 C A 1: 72,312,436 A55E probably damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 splice site probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4931061 missense probably benign 0.09
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4917131 missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4949105 missense probably benign 0.36
R7848:Mroh2b UTSW 15 4938379 nonsense probably null
R7952:Mroh2b UTSW 15 4951211 missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4921357 nonsense probably null
R8207:Mroh2b UTSW 15 4938410 missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4909040 missense probably benign 0.04
R8248:Mroh2b UTSW 15 4931104 missense probably benign 0.40
R8258:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8259:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8304:Mroh2b UTSW 15 4925637 missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4951264 nonsense probably null
R8345:Mroh2b UTSW 15 4944326 missense probably benign 0.09
R8507:Mroh2b UTSW 15 4949090 missense probably damaging 1.00
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4905005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAAAGGAGACTGGAGACCGAC -3'
(R):5'- CCTCAGGGTTACAAATCTGGCA -3'

Sequencing Primer
(F):5'- CCGACAAGAAGTGAATATCTGTGAC -3'
(R):5'- CAGGGTTACAAATCTGGCATTTCC -3'
Posted On2020-06-30